Showing posts with label legendary. Show all posts
Showing posts with label legendary. Show all posts

Sunday, September 14, 2014

[Legendary] Zaire Ebola Virus Complete Genome

>gi|10313991|ref|NC_002549.1| Zaire ebolavirus isolate Ebola virus 
H.sapiens-tc/COD/1976/Yambuku-Mayinga, complete genome

CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
TTTTCCTCTCATTGAAATTTATATCGGAATTTAAATTGAAATTGTTACTGTAATCACACCTGGTTTGTTT
CAGAGCCACATCACAAAGATAGAGAACAACCTAGGTCTCCGAAGGGAGCAAGGGCATCAGTGTGCTCAGT
TGAAAATCCCTTGTCAACACCTAGGTCTTATCACATCACAAGTTCCACCTCAGACTCTGCAGGGTGATCC
AACAACCTTAATAGAAACATTATTGTTAAAGGACAGCATTAGTTCACAGTCAAACAAGCAAGATTGAGAA
TTAACCTTGGTTTTGAACTTGAACACTTAGGGGATTGAAGATTCAACAACCCTAAAGCTTGGGGTAAAAC
ATTGGAAATAGTTAAAAGACAAATTGCTCGGAATCACAAAATTCCGAGTATGGATTCTCGTCCTCAGAAA
ATCTGGATGGCGCCGAGTCTCACTGAATCTGACATGGATTACCACAAGATCTTGACAGCAGGTCTGTCCG
TTCAACAGGGGATTGTTCGGCAAAGAGTCATCCCAGTGTATCAAGTAAACAATCTTGAAGAAATTTGCCA
ACTTATCATACAGGCCTTTGAAGCAGGTGTTGATTTTCAAGAGAGTGCGGACAGTTTCCTTCTCATGCTT
TGTCTTCATCATGCGTACCAGGGAGATTACAAACTTTTCTTGGAAAGTGGCGCAGTCAAGTATTTGGAAG
GGCACGGGTTCCGTTTTGAAGTCAAGAAGCGTGATGGAGTGAAGCGCCTTGAGGAATTGCTGCCAGCAGT
ATCTAGTGGAAAAAACATTAAGAGAACACTTGCTGCCATGCCGGAAGAGGAGACAACTGAAGCTAATGCC
GGTCAGTTTCTCTCCTTTGCAAGTCTATTCCTTCCGAAATTGGTAGTAGGAGAAAAGGCTTGCCTTGAGA
AGGTTCAAAGGCAAATTCAAGTACATGCAGAGCAAGGACTGATACAATATCCAACAGCTTGGCAATCAGT
AGGACACATGATGGTGATTTTCCGTTTGATGCGAACAAATTTTCTGATCAAATTTCTCCTAATACACCAA
GGGATGCACATGGTTGCCGGGCATGATGCCAACGATGCTGTGATTTCAAATTCAGTGGCTCAAGCTCGTT
TTTCAGGCTTATTGATTGTCAAAACAGTACTTGATCATATCCTACAAAAGACAGAACGAGGAGTTCGTCT
CCATCCTCTTGCAAGGACCGCCAAGGTAAAAAATGAGGTGAACTCCTTTAAGGCTGCACTCAGCTCCCTG
GCCAAGCATGGAGAGTATGCTCCTTTCGCCCGACTTTTGAACCTTTCTGGAGTAAATAATCTTGAGCATG
GTCTTTTCCCTCAACTATCGGCAATTGCACTCGGAGTCGCCACAGCACACGGGAGTACCCTCGCAGGAGT
AAATGTTGGAGAACAGTATCAACAACTCAGAGAGGCTGCCACTGAGGCTGAGAAGCAACTCCAACAATAT
GCAGAGTCTCGCGAACTTGACCATCTTGGACTTGATGATCAGGAAAAGAAAATTCTTATGAACTTCCATC
AGAAAAAGAACGAAATCAGCTTCCAGCAAACAAACGCTATGGTAACTCTAAGAAAAGAGCGCCTGGCCAA
GCTGACAGAAGCTATCACTGCTGCGTCACTGCCCAAAACAAGTGGACATTACGATGATGATGACGACATT
CCCTTTCCAGGACCCATCAATGATGACGACAATCCTGGCCATCAAGATGATGATCCGACTGACTCACAGG
ATACGACCATTCCCGATGTGGTGGTTGATCCCGATGATGGAAGCTACGGCGAATACCAGAGTTACTCGGA
AAACGGCATGAATGCACCAGATGACTTGGTCCTATTCGATCTAGACGAGGACGACGAGGACACTAAGCCA
GTGCCTAATAGATCGACCAAGGGTGGACAACAGAAGAACAGTCAAAAGGGCCAGCATATAGAGGGCAGAC
AGACACAATCCAGGCCAATTCAAAATGTCCCAGGCCCTCACAGAACAATCCACCACGCCAGTGCGCCACT
CACGGACAATGACAGAAGAAATGAACCCTCCGGCTCAACCAGCCCTCGCATGCTGACACCAATTAACGAA
GAGGCAGACCCACTGGACGATGCCGACGACGAGACGTCTAGCCTTCCGCCCTTGGAGTCAGATGATGAAG
AGCAGGACAGGGACGGAACTTCCAACCGCACACCCACTGTCGCCCCACCGGCTCCCGTATACAGAGATCA
CTCTGAAAAGAAAGAACTCCCGCAAGACGAGCAACAAGATCAGGACCACACTCAAGAGGCCAGGAACCAG
GACAGTGACAACACCCAGTCAGAACACTCTTTTGAGGAGATGTATCGCCACATTCTAAGATCACAGGGGC
CATTTGATGCTGTTTTGTATTATCATATGATGAAGGATGAGCCTGTAGTTTTCAGTACCAGTGATGGCAA
AGAGTACACGTATCCAGACTCCCTTGAAGAGGAATATCCACCATGGCTCACTGAAAAAGAGGCTATGAAT
GAAGAGAATAGATTTGTTACATTGGATGGTCAACAATTTTATTGGCCGGTGATGAATCACAAGAATAAAT
TCATGGCAATCCTGCAACATCATCAGTGAATGAGCATGGAACAATGGGATGATTCAACCGACAAATAGCT
AACATTAAGTAGTCAAGGAACGAAAACAGGAAGAATTTTTGATGTCTAAGGTGTGAATTATTATCACAAT
AAAAGTGATTCTTATTTTTGAATTTAAAGCTAGCTTATTATTACTAGCCGTTTTTCAAAGTTCAATTTGA
GTCTTAATGCAAATAGGCGTTAAGCCACAGTTATAGCCATAATTGTAACTCAATATTCTAACTAGCGATT
TATCTAAATTAAATTACATTATGCTTTTATAACTTACCTACTAGCCTGCCCAACATTTACACGATCGTTT
TATAATTAAGAAAAAACTAATGATGAAGATTAAAACCTTCATCATCCTTACGTCAATTGAATTCTCTAGC
ACTCGAAGCTTATTGTCTTCAATGTAAAAGAAAAGCTGGTCTAACAAGATGACAACTAGAACAAAGGGCA
GGGGCCATACTGCGGCCACGACTCAAAACGACAGAATGCCAGGCCCTGAGCTTTCGGGCTGGATCTCTGA
GCAGCTAATGACCGGAAGAATTCCTGTAAGCGACATCTTCTGTGATATTGAGAACAATCCAGGATTATGC
TACGCATCCCAAATGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGTCAAACCCAAACGGACCCAA
TTTGCAATCATAGTTTTGAGGAGGTAGTACAAACATTGGCTTCATTGGCTACTGTTGTGCAACAACAAAC
CATCGCATCAGAATCATTAGAACAACGCATTACGAGTCTTGAGAATGGTCTAAAGCCAGTTTATGATATG
GCAAAAACAATCTCCTCATTGAACAGGGTTTGTGCTGAGATGGTTGCAAAATATGATCTTCTGGTGATGA
CAACCGGTCGGGCAACAGCAACCGCTGCGGCAACTGAGGCTTATTGGGCCGAACATGGTCAACCACCACC
TGGACCATCACTTTATGAAGAAAGTGCGATTCGGGGTAAGATTGAATCTAGAGATGAGACCGTCCCTCAA
AGTGTTAGGGAGGCATTCAACAATCTAAACAGTACCACTTCACTAACTGAGGAAAATTTTGGGAAACCTG
ACATTTCGGCAAAGGATTTGAGAAACATTATGTATGATCACTTGCCTGGTTTTGGAACTGCTTTCCACCA
ATTAGTACAAGTGATTTGTAAATTGGGAAAAGATAGCAACTCATTGGACATCATTCATGCTGAGTTCCAG
GCCAGCCTGGCTGAAGGAGACTCTCCTCAATGTGCCCTAATTCAAATTACAAAAAGAGTTCCAATCTTCC
AAGATGCTGCTCCACCTGTCATCCACATCCGCTCTCGAGGTGACATTCCCCGAGCTTGCCAGAAAAGCTT
GCGTCCAGTCCCACCATCGCCCAAGATTGATCGAGGTTGGGTATGTGTTTTTCAGCTTCAAGATGGTAAA
ACACTTGGACTCAAAATTTGAGCCAATCTCCCTTCCCTCCGAAAGAGGCGAATAATAGCAGAGGCTTCAA
CTGCTGAACTATAGGGTACGTTACATTAATGATACACTTGTGAGTATCAGCCCTGGATAATATAAGTCAA
TTAAACGACCAAGATAAAATTGTTCATATCTCGCTAGCAGCTTAAAATATAAATGTAATAGGAGCTATAT
CTCTGACAGTATTATAATCAATTGTTATTAAGTAACCCAAACCAAAAGTGATGAAGATTAAGAAAAACCT
ACCTCGGCTGAGAGAGTGTTTTTTCATTAACCTTCATCTTGTAAACGTTGAGCAAAATTGTTAAAAATAT
GAGGCGGGTTATATTGCCTACTGCTCCTCCTGAATATATGGAGGCCATATACCCTGTCAGGTCAAATTCA
ACAATTGCTAGAGGTGGCAACAGCAATACAGGCTTCCTGACACCGGAGTCAGTCAATGGGGACACTCCAT
CGAATCCACTCAGGCCAATTGCCGATGACACCATCGACCATGCCAGCCACACACCAGGCAGTGTGTCATC
AGCATTCATCCTTGAAGCTATGGTGAATGTCATATCGGGCCCCAAAGTGCTAATGAAGCAAATTCCAATT
TGGCTTCCTCTAGGTGTCGCTGATCAAAAGACCTACAGCTTTGACTCAACTACGGCCGCCATCATGCTTG
CTTCATACACTATCACCCATTTCGGCAAGGCAACCAATCCACTTGTCAGAGTCAATCGGCTGGGTCCTGG
AATCCCGGATCATCCCCTCAGGCTCCTGCGAATTGGAAACCAGGCTTTCCTCCAGGAGTTCGTTCTTCCG
CCAGTCCAACTACCCCAGTATTTCACCTTTGATTTGACAGCACTCAAACTGATCACCCAACCACTGCCTG
CTGCAACATGGACCGATGACACTCCAACAGGATCAAATGGAGCGTTGCGTCCAGGAATTTCATTTCATCC
AAAACTTCGCCCCATTCTTTTACCCAACAAAAGTGGGAAGAAGGGGAACAGTGCCGATCTAACATCTCCG
GAGAAAATCCAAGCAATAATGACTTCACTCCAGGACTTTAAGATCGTTCCAATTGATCCAACCAAAAATA
TCATGGGAATCGAAGTGCCAGAAACTCTGGTCCACAAGCTGACCGGTAAGAAGGTGACTTCTAAAAATGG
ACAACCAATCATCCCTGTTCTTTTGCCAAAGTACATTGGGTTGGACCCGGTGGCTCCAGGAGACCTCACC
ATGGTAATCACACAGGATTGTGACACGTGTCATTCTCCTGCAAGTCTTCCAGCTGTGATTGAGAAGTAAT
TGCAATAATTGACTCAGATCCAGTTTTATAGAATCTTCTCAGGGATAGTGATAACATCTATTTAGTAATC
CGTCCATTAGAGGAGACACTTTTAATTGATCAATATACTAAAGGTGCTTTACACCATTGTCTTTTTTCTC
TCCTAAATGTAGAACTTAACAAAAGACTCATAATATACTTGTTTTTAAAGGATTGATTGATGAAAGATCA
TAACTAATAACATTACAAATAATCCTACTATAATCAATACGGTGATTCAAATGTTAATCTTTCTCATTGC
ACATACTTTTTGCCCTTATCCTCAAATTGCCTGCATGCTTACATCTGAGGATAGCCAGTGTGACTTGGAT
TGGAAATGTGGAGAAAAAATCGGGACCCATTTCTAGGTTGTTCACAATCCAAGTACAGACATTGCCCTTC
TAATTAAGAAAAAATCGGCGATGAAGATTAAGCCGACAGTGAGCGTAATCTTCATCTCTCTTAGATTATT
TGTTTTCCAGAGTAGGGGTCGTCAGGTCCTTTTCAATCGTGTAACCAAAATAAACTCCACTAGAAGGATA
TTGTGGGGCAACAACACAATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACAT
CATTCTTTCTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAGTCATCCACAATAG
CACATTACAGGTTAGTGATGTCGACAAACTAGTTTGTCGTGACAAACTGTCATCCACAAATCAATTGAGA
TCAGTTGGACTGAATCTCGAAGGGAATGGAGTGGCAACTGACGTGCCATCTGCAACTAAAAGATGGGGCT
TCAGGTCCGGTGTCCCACCAAAGGTGGTCAATTATGAAGCTGGTGAATGGGCTGAAAACTGCTACAATCT
TGAAATCAAAAAACCTGACGGGAGTGAGTGTCTACCAGCAGCGCCAGACGGGATTCGGGGCTTCCCCCGG
TGCCGGTATGTGCACAAAGTATCAGGAACGGGACCGTGTGCCGGAGACTTTGCCTTCCATAAAGAGGGTG
CTTTCTTCCTGTATGATCGACTTGCTTCCACAGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGT
TGCATTTCTGATACTGCCCCAAGCTAAGAAGGACTTCTTCAGCTCACACCCCTTGAGAGAGCCGGTCAAT
GCAACGGAGGACCCGTCTAGTGGCTACTATTCTACCACAATTAGATATCAGGCTACCGGTTTTGGAACCA
ATGAGACAGAGTACTTGTTCGAGGTTGACAATTTGACCTACGTCCAACTTGAATCAAGATTCACACCACA
GTTTCTGCTCCAGCTGAATGAGACAATATATACAAGTGGGAAAAGGAGCAATACCACGGGAAAACTAATT
TGGAAGGTCAACCCCGAAATTGATACAACAATCGGGGAGTGGGCCTTCTGGGAAACTAAAAAAACCTCAC
TAGAAAAATTCGCAGTGAAGAGTTGTCTTTCACAGTTGTATCAAACGGAGCCAAAAACATCAGTGGTCAG
AGTCCGGCGCGAACTTCTTCCGACCCAGGGACCAACACAACAACTGAAGACCACAAAATCATGGCTTCAG
AAAATTCCTCTGCAATGGTTCAAGTGCACAGTCAAGGAAGGGAAGCTGCAGTGTCGCATCTAACAACCCT
TGCCACAATCTCCACGAGTCCCCAATCCCTCACAACCAAACCAGGTCCGGACAACAGCACCCATAATACA
CCCGTGTATAAACTTGACATCTCTGAGGCAACTCAAGTTGAACAACATCACCGCAGAACAGACAACGACA
GCACAGCCTCCGACACTCCCTCTGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAG
CAAGAGCACTGACTTCCTGGACCCCGCCACCACAACAAGTCCCCAAAACCACAGCGAGACCGCTGGCAAC
AACAACACTCATCACCAAGATACCGGAGAAGAGAGTGCCAGCAGCGGGAAGCTAGGCTTAATTACCAATA
CTATTGCTGGAGTCGCAGGACTGATCACAGGCGGGAGAAGAACTCGAAGAGAAGCAATTGTCAATGCTCA
ACCCAAATGCAACCCTAATTTACATTACTGGACTACTCAGGATGAAGGTGCTGCAATCGGACTGGCCTGG
ATACCATATTTCGGGCCAGCAGCCGAGGGAATTTACATAGAGGGGCTAATGCACAATCAAGATGGTTTAA
TCTGTGGGTTGAGACAGCTGGCCAACGAGACGACTCAAGCTCTTCAACTGTTCCTGAGAGCCACAACTGA
GCTACGCACCTTTTCAATCCTCAACCGTAAGGCAATTGATTTCTTGCTGCAGCGATGGGGCGGCACATGC
CACATTCTGGGACCGGACTGCTGTATCGAACCACATGATTGGACCAAGAACATAACAGACAAAATTGATC
AGATTATTCATGATTTTGTTGATAAAACCCTTCCGGACCAGGGGGACAATGACAATTGGTGGACAGGATG
GAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTTATTCTGTATA
TGCAAATTTGTCTTTTAGTTTTTCTTCAGATTGCTTCATGGAAAAGCTCAGCCTCAAATCAATGAAACCA
GGATTTAATTATATGGATTACTTGAATCTAAGATTACTTGACAAATGATAATATAATACACTGGAGCTTT
AAACATAGCCAATGTGATTCTAACTCCTTTAAACTCACAGTTAATCATAAACAAGGTTTGACATCAATCT
AGTTATCTCTTTGAGAATGATAAACTTGATGAAGATTAAGAAAAAGGTAATCTTTCGATTATCTTTAATC
TTCATCCTTGATTCTACAATCATGACAGTTGTCTTTAGTGACAAGGGAAAGAAGCCTTTTTATTAAGTTG
TAATAATCAGATCTGCGAACCGGTAGAGTTTAGTTGCAACCTAACACACATAAAGCATTGGTCAAAAAGT
CAATAGAAATTTAAACAGTGAGTGGAGACAACTTTTAAATGGAAGCTTCATATGAGAGAGGACGCCCACG
AGCTGCCAGACAGCATTCAAGGGATGGACACGACCACCATGTTCGAGCACGATCATCATCCAGAGAGAAT
TATCGAGGTGAGTACCGTCAATCAAGGAGCGCCTCACAAGTGCGCGTTCCTACTGTATTTCATAAGAAGA
GAGTTGAACCATTAACAGTTCCTCCAGCACCTAAAGACATATGTCCGACCTTGAAAAAAGGATTTTTGTG
TGACAGTAGTTTTTGCAAAAAAGATCACCAGTTGGAGAGTTTAACTGATAGGGAATTACTCCTACTAATC
GCCCGTAAGACTTGTGGATCAGTAGAACAACAATTAAATATAACTGCACCCAAGGACTCGCGCTTAGCAA
ATCCAACGGCTGATGATTTCCAGCAAGAGGAAGGTCCAAAAATTACCTTGTTGACACTGATCAAGACGGC
AGAACACTGGGCGAGACAAGACATCAGAACCATAGAGGATTCAAAATTAAGAGCATTGTTGACTCTATGT
GCTGTGATGACGAGGAAATTCTCAAAATCCCAGCTGAGTCTTTTATGTGAGACACACCTAAGGCGCGAGG
GGCTTGGGCAAGATCAGGCAGAACCCGTTCTCGAAGTATATCAACGATTACACAGTGATAAAGGAGGCAG
TTTTGAAGCTGCACTATGGCAACAATGGGACCGACAATCCCTAATTATGTTTATCACTGCATTCTTGAAT
ATTGCTCTCCAGTTACCGTGTGAAAGTTCTGCTGTCGTTGTTTCAGGGTTAAGAACATTGGTTCCTCAAT
CAGATAATGAGGAAGCTTCAACCAACCCGGGGACATGCTCATGGTCTGATGAGGGTACCCCTTAATAAGG
CTGACTAAAACACTATATAACCTTCTACTTGATCACAATACTCCGTATACCTATCATCATATATTTAATC
AAGACGATATCCTTTAAAACTTATTCAGTACTATAATCACTCTCGTTTCAAATTAATAAGATGTGCATGA
TTGCCCTAATATATGAAGAGGTATGATACAACCCTAACAGTGATCAAAGAAAATCATAATCTCGTATCGC
TCGTAATATAACCTGCCAAGCATACCTCTTGCACAAAGTGATTCTTGTACACAAATAATGTTTTACTCTA
CAGGAGGTAGCAACGATCCATCCCATCAAAAAATAAGTATTTCATGACTTACTAATGATCTCTTAAAATA
TTAAGAAAAACTGACGGAACATAAATTCTTTATGCTTCAAGCTGTGGAGGAGGTGTTTGGTATTGGCTAT
TGTTATATTACAATCAATAACAAGCTTGTAAAAATATTGTTCTTGTTTCAAGAGGTAGATTGTGACCGGA
AATGCTAAACTAATGATGAAGATTAATGCGGAGGTCTGATAAGAATAAACCTTATTATTCAGATTAGGCC
CCAAGAGGCATTCTTCATCTCCTTTTAGCAAAGTACTATTTCAGGGTAGTCCAATTAGTGGCACGTCTTT
TAGCTGTATATCAGTCGCCCCTGAGATACGCCACAAAAGTGTCTCTAAGCTAAATTGGTCTGTACACATC
CCATACATTGTATTAGGGGCAATAATATCTAATTGAACTTAGCCGTTTAAAATTTAGTGCATAAATCTGG
GCTAACACCACCAGGTCAACTCCATTGGCTGAAAAGAAGCTTACCTACAACGAACATCACTTTGAGCGCC
CTCACAATTAAAAAATAGGAACGTCGTTCCAACAATCGAGCGCAAGGTTTCAAGGTTGAACTGAGAGTGT
CTAGACAACAAAATATTGATACTCCAGACACCAAGCAAGACCTGAGAAAAAACCATGGCTAAAGCTACGG
GACGATACAATCTAATATCGCCCAAAAAGGACCTGGAGAAAGGGGTTGTCTTAAGCGACCTCTGTAACTT
CTTAGTTAGCCAAACTATTCAGGGGTGGAAGGTTTATTGGGCTGGTATTGAGTTTGATGTGACTCACAAA
GGAATGGCCCTATTGCATAGACTGAAAACTAATGACTTTGCCCCTGCATGGTCAATGACAAGGAATCTCT
TTCCTCATTTATTTCAAAATCCGAATTCCACAATTGAATCACCGCTGTGGGCATTGAGAGTCATCCTTGC
AGCAGGGATACAGGACCAGCTGATTGACCAGTCTTTGATTGAACCCTTAGCAGGAGCCCTTGGTCTGATC
TCTGATTGGCTGCTAACAACCAACACTAACCATTTCAACATGCGAACACAACGTGTCAAGGAACAATTGA
GCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACAAATTGGATGCTCTACATGT
CGTGAACTACAACGGATTGTTGAGCAGTATTGAAATTGGAACTCAAAATCATACAATCATCATAACTCGA
ACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCATGAAGCCTGGGC
CGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCATTTACACAAGGATCCTCGACACGAATGCA
AAGTTTGATTCTTGAATTTAATAGCTCTCTTGCTATCTAACTAAGGTAGAATACTTCATATTGAGCTAAC
TCATATATGCTGACTCAATAGTTATCTTGACATCTCTGCTTTCATAATCAGATATATAAGCATAATAAAT
AAATACTCATATTTCTTGATAATTTGTTTAACCACAGATAAATCCTCACTGTAAGCCAGCTTCCAAGTTG
ACACCCTTACAAAAACCAGGACTCAGAATCCCTCAAACAAGAGATTCCAAGACAACATCATAGAATTGCT
TTATTATATGAATAAGCATTTTATCACCAGAAATCCTATATACTAAATGGTTAATTGTAACTGAACCCGC
AGGTCACATGTGTTAGGTTTCACAGATTCTATATATTACTAACTCTATACTCGTAATTAACATTAGATAA
GTAGATTAAGAAAAAAGCCTGAGGAAGATTAAGAAAAACTGCTTATTGGGTCTTTCCGTGTTTTAGATGA
AGCAGTTGAAATTCTTCCTCTTGATATTAAATGGCTACACAACATACCCAATACCCAGACGCTAGGTTAT
CATCACCAATTGTATTGGACCAATGTGACCTAGTCACTAGAGCTTGCGGGTTATATTCATCATACTCCCT
TAATCCGCAACTACGCAACTGTAAACTCCCGAAACATATCTACCGTTTGAAATACGATGTAACTGTTACC
AAGTTCTTGAGTGATGTACCAGTGGCGACATTGCCCATAGATTTCATAGTCCCAGTTCTTCTCAAGGCAC
TGTCAGGCAATGGATTCTGTCCTGTTGAGCCGCGGTGCCAACAGTTCTTAGATGAAATCATTAAGTACAC
AATGCAAGATGCTCTCTTCTTGAAATATTATCTCAAAAATGTGGGTGCTCAAGAAGACTGTGTTGATGAA
CACTTTCAAGAGAAAATCTTATCTTCAATTCAGGGCAATGAATTTTTACATCAAATGTTTTTCTGGTATG
ATCTGGCTATTTTAACTCGAAGGGGTAGATTAAATCGAGGAAACTCTAGATCAACATGGTTTGTTCATGA
TGATTTAATAGACATCTTAGGCTATGGGGACTATGTTTTTTGGAAGATCCCAATTTCAATGTTACCACTG
AACACACAAGGAATCCCCCATGCTGCTATGGACTGGTATCAGGCATCAGTATTCAAAGAAGCGGTTCAAG
GGCATACACACATTGTTTCTGTTTCTACTGCCGACGTCTTGATAATGTGCAAAGATTTAATTACATGTCG
ATTCAACACAACTCTAATCTCAAAAATAGCAGAGATTGAGGATCCAGTTTGTTCTGATTATCCCAATTTT
AAGATTGTGTCTATGCTTTACCAGAGCGGAGATTACTTACTCTCCATATTAGGGTCTGATGGGTATAAAA
TTATTAAGTTCCTCGAACCATTGTGCTTGGCCAAAATTCAATTATGCTCAAAGTACACTGAGAGGAAGGG
CCGATTCTTAACACAAATGCATTTAGCTGTAAATCACACCCTAGAAGAAATTACAGAAATGCGTGCACTA
AAGCCTTCACAGGCTCAAAAGATCCGTGAATTCCATAGAACATTGATAAGGCTGGAGATGACGCCACAAC
AACTTTGTGAGCTATTTTCCATTCAAAAACACTGGGGGCATCCTGTGCTACATAGTGAAACAGCAATCCA
AAAAGTTAAAAAACATGCTACGGTGCTAAAAGCATTACGCCCTATAGTGATTTTCGAGACATACTGTGTT
TTTAAATATAGTATTGCCAAACATTATTTTGATAGTCAAGGATCTTGGTACAGTGTTACTTCAGATAGGA
ATCTAACACCGGGTCTTAATTCTTATATCAAAAGAAATCAATTCCCTCCGTTGCCAATGATTAAAGAACT
ACTATGGGAATTTTACCACCTTGACCACCCTCCACTTTTCTCAACCAAAATTATTAGTGACTTAAGTATT
TTTATAAAAGACAGAGCTACCGCAGTAGAAAGGACATGCTGGGATGCAGTATTCGAGCCTAATGTTCTAG
GATATAATCCACCTCACAAATTTAGTACTAAACGTGTACCGGAACAATTTTTAGAGCAAGAAAACTTTTC
TATTGAGAATGTTCTTTCCTACGCACAAAAACTCGAGTATCTACTACCACAATATCGGAACTTTTCTTTC
TCATTGAAAGAGAAAGAGTTGAATGTAGGTAGAACCTTCGGAAAATTGCCTTATCCGACTCGCAATGTTC
AAACACTTTGTGAAGCTCTGTTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTTAC
GGAACGTGAGCAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAA
CATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTTAGATATGAGT
TTACAGCACCTTTTATAGAATATTGCAACCGTTGCTATGGTGTTAAGAATGTTTTTAATTGGATGCATTA
TACAATCCCACAGTGTTATATGCATGTCAGTGATTATTATAATCCACCACATAACCTCACACTGGAGAAT
CGAGACAACCCCCCCGAAGGGCCTAGTTCATACAGGGGTCATATGGGAGGGATTGAAGGACTGCAACAAA
AACTCTGGACAAGTATTTCATGTGCTCAAATTTCTTTAGTTGAAATTAAGACTGGTTTTAAGTTACGCTC
AGCTGTGATGGGTGACAATCAGTGCATTACTGTTTTATCAGTCTTCCCCTTAGAGACTGACGCAGACGAG
CAGGAACAGAGCGCCGAAGACAATGCAGCGAGGGTGGCCGCCAGCCTAGCAAAAGTTACAAGTGCCTGTG
GAATCTTTTTAAAACCTGATGAAACATTTGTACATTCAGGTTTTATCTATTTTGGAAAAAAACAATATTT
GAATGGGGTCCAATTGCCTCAGTCCCTTAAAACGGCTACAAGAATGGCACCATTGTCTGATGCAATTTTT
GATGATCTTCAAGGGACCCTGGCTAGTATAGGCACTGCTTTTGAGCGATCCATCTCTGAGACACGACATA
TCTTTCCTTGCAGGATAACCGCAGCTTTCCATACGTTTTTTTCGGTGAGAATCTTGCAATATCATCATCT
CGGGTTCAATAAAGGTTTTGACCTTGGACAGTTAACACTCGGCAAACCTCTGGATTTCGGAACAATATCA
TTGGCACTAGCGGTACCGCAGGTGCTTGGAGGGTTATCCTTCTTGAATCCTGAGAAATGTTTCTACCGGA
ATCTAGGAGATCCAGTTACCTCAGGCTTATTCCAGTTAAAAACTTATCTCCGAATGATTGAGATGGATGA
TTTATTCTTACCTTTAATTGCGAAGAACCCTGGGAACTGCACTGCCATTGACTTTGTGCTAAATCCTAGC
GGATTAAATGTCCCTGGGTCGCAAGACTTAACTTCATTTCTGCGCCAGATTGTACGCAGGACCATCACCC
TAAGTGCGAAAAACAAACTTATTAATACCTTATTTCATGCGTCAGCTGACTTCGAAGACGAAATGGTTTG
TAAATGGCTATTATCATCAACTCCTGTTATGAGTCGTTTTGCGGCCGATATCTTTTCACGCACGCCGAGC
GGGAAGCGATTGCAAATTCTAGGATACCTGGAAGGAACACGCACATTATTAGCCTCTAAGATCATCAACA
ATAATACAGAGACACCGGTTTTGGACAGACTGAGGAAAATAACATTGCAAAGGTGGAGCCTATGGTTTAG
TTATCTTGATCATTGTGATAATATCCTGGCGGAGGCTTTAACCCAAATAACTTGCACAGTTGATTTAGCA
CAGATTCTGAGGGAATATTCATGGGCTCATATTTTAGAGGGAAGACCTCTTATTGGAGCCACACTCCCAT
GTATGATTGAGCAATTCAAAGTGTTTTGGCTGAAACCCTACGAACAATGTCCGCAGTGTTCAAATGCAAA
GCAACCAGGTGGGAAACCATTCGTGTCAGTGGCAGTCAAGAAACATATTGTTAGTGCATGGCCGAACGCA
TCCCGAATAAGCTGGACTATCGGGGATGGAATCCCATACATTGGATCAAGGACAGAAGATAAGATAGGAC
AACCTGCTATTAAACCAAAATGTCCTTCCGCAGCCTTAAGAGAGGCCATTGAATTGGCGTCCCGTTTAAC
ATGGGTAACTCAAGGCAGTTCGAACAGTGACTTGCTAATAAAACCATTTTTGGAAGCACGAGTAAATTTA
AGTGTTCAAGAAATACTTCAAATGACCCCTTCACATTACTCAGGAAATATTGTTCACAGGTACAACGATC
AATACAGTCCTCATTCTTTCATGGCCAATCGTATGAGTAATTCAGCAACGCGATTGATTGTTTCTACAAA
CACTTTAGGTGAGTTTTCAGGAGGTGGCCAGTCTGCACGCGACAGCAATATTATTTTCCAGAATGTTATA
AATTATGCAGTTGCACTGTTCGATATTAAATTTAGAAACACTGAGGCTACAGATATCCAATATAATCGTG
CTCACCTTCATCTAACTAAGTGTTGCACCCGGGAAGTACCAGCTCAGTATTTAACATACACATCTACATT
GGATTTAGATTTAACAAGATACCGAGAAAACGAATTGATTTATGACAGTAATCCTCTAAAAGGAGGACTC
AATTGCAATATCTCATTCGATAATCCATTTTTCCAAGGTAAACGGCTGAACATTATAGAAGATGATCTTA
TTCGACTGCCTCACTTATCTGGATGGGAGCTAGCCAAGACCATCATGCAATCAATTATTTCAGATAGCAA
CAATTCATCTACAGACCCAATTAGCAGTGGAGAAACAAGATCATTCACTACCCATTTCTTAACTTATCCC
AAGATAGGACTTCTGTACAGTTTTGGGGCCTTTGTAAGTTATTATCTTGGCAATACAATTCTTCGGACTA
AGAAATTAACACTTGACAATTTTTTATATTACTTAACTACTCAAATTCATAATCTACCACATCGCTCATT
GCGAATACTTAAGCCAACATTCAAACATGCAAGCGTTATGTCACGGTTAATGAGTATTGATCCTCATTTT
TCTATTTACATAGGCGGTGCTGCAGGTGACAGAGGACTCTCAGATGCGGCCAGGTTATTTTTGAGAACGT
CCATTTCATCTTTTCTTACATTTGTAAAAGAATGGATAATTAATCGCGGAACAATTGTCCCTTTATGGAT
AGTATATCCGCTAGAGGGTCAAAACCCAACACCTGTGAATAATTTTCTCTATCAGATCGTAGAACTGCTG
GTGCATGATTCATCAAGACAACAGGCTTTTAAAACTACCATAAGTGATCATGTACATCCTCACGACAATC
TTGTTTACACATGTAAGAGTACAGCCAGCAATTTCTTCCATGCATCATTGGCGTACTGGAGGAGCAGACA
CAGAAACAGCAACCGAAAATACTTGGCAAGAGACTCTTCAACTGGATCAAGCACAAACAACAGTGATGGT
CATATTGAGAGAAGTCAAGAACAAACCACCAGAGATCCACATGATGGCACTGAACGGAATCTAGTCCTAC
AAATGAGCCATGAAATAAAAAGAACGACAATTCCACAAGAAAACACGCACCAGGGTCCGTCGTTCCAGTC
CTTTCTAAGTGACTCTGCTTGTGGTACAGCAAATCCAAAACTAAATTTCGATCGATCGAGACACAATGTG
AAATTTCAGGATCATAACTCGGCATCCAAGAGGGAAGGTCATCAAATAATCTCACACCGTCTAGTCCTAC
CTTTCTTTACATTATCTCAAGGGACACGCCAATTAACGTCATCCAATGAGTCACAAACCCAAGACGAGAT
ATCAAAGTACTTACGGCAATTGAGATCCGTCATTGATACCACAGTTTATTGTAGATTTACCGGTATAGTC
TCGTCCATGCATTACAAACTTGATGAGGTCCTTTGGGAAATAGAGAGTTTCAAGTCGGCTGTGACGCTAG
CAGAGGGAGAAGGTGCTGGTGCCTTACTATTGATTCAGAAATACCAAGTTAAGACCTTATTTTTCAACAC
GCTAGCTACTGAGTCCAGTATAGAGTCAGAAATAGTATCAGGAATGACTACTCCTAGGATGCTTCTACCT
GTTATGTCAAAATTCCATAATGACCAAATTGAGATTATTCTTAACAACTCAGCAAGCCAAATAACAGACA
TAACAAATCCTACTTGGTTTAAAGACCAAAGAGCAAGGCTACCTAAGCAAGTCGAGGTTATAACCATGGA
TGCAGAGACAACAGAGAATATAAACAGATCGAAATTGTACGAAGCTGTATATAAATTGATCTTACACCAT
ATTGATCCTAGCGTATTGAAAGCAGTGGTCCTTAAAGTCTTTCTAAGTGATACTGAGGGTATGTTATGGC
TAAATGATAATTTAGCCCCGTTTTTTGCCACTGGTTATTTAATTAAGCCAATAACGTCAAGTGCTAGATC
TAGTGAGTGGTATCTTTGTCTGACGAACTTCTTATCAACTACACGTAAGATGCCACACCAAAACCATCTC
AGTTGTAAACAGGTAATACTTACGGCATTGCAACTGCAAATTCAACGAAGCCCATACTGGCTAAGTCATT
TAACTCAGTATGCTGACTGTGAGTTACATTTAAGTTATATCCGCCTTGGTTTTCCATCATTAGAGAAAGT
ACTATACCACAGGTATAACCTCGTCGATTCAAAAAGAGGTCCACTAGTCTCTATCACTCAGCACTTAGCA
CATCTTAGAGCAGAGATTCGAGAATTAACTAATGATTATAATCAACAGCGACAAAGTCGGACTCAAACAT
ATCACTTTATTCGTACTGCAAAAGGACGAATCACAAAACTAGTCAATGATTATTTAAAATTCTTTCTTAT
TGTGCAAGCATTAAAACATAATGGGACATGGCAAGCTGAGTTTAAGAAATTACCAGAGTTGATTAGTGTG
TGCAATAGGTTCTACCATATTAGAGATTGCAATTGTGAAGAACGTTTCTTAGTTCAAACCTTATATTTAC
ATAGAATGCAGGATTCTGAAGTTAAGCTTATCGAAAGGCTGACAGGGCTTCTGAGTTTATTTCCGGATGG
TCTCTACAGGTTTGATTGAATTACCGTGCATAGTATCCTGATACTTGCAAAGGTTGGTTATTAACATACA
GATTATAAAAAACTCATAAATTGCTCTCATACATCATATTGATCTAATCTCAATAAACAACTATTTAAAT
AACGAAAGGAGTCCCTATATTATATACTATATTTAGCCTCTCTCCCTGCGTGATAATCAAAAAATTCACA
ATGCAGCATGTGTGACATATTACTGCCGCAATGAATTTAACGCAACATAATAAACTCTGCACTCTTTATA
ATTAAGCTTTAACGAAAGGTCTGGGCTCATATTGTTATTGATATAATAATGTTGTATCAATATCCTGTCA
GATGGAATAGTGTTTTGGTTGATAACACAACTTCTTAAAACAAAATTGATCTTTAAGATTAAGTTTTTTA
TAATTATCATTACTTTAATTTGTCGTTTTAAAAACGGTGATAGCCTTAATCTTTGTGTAAAATAAGAGAT
TAGGTGTAATAACCTTAACATTTTTGTCTAGTAAGCTACTATTTCATACAGAATGATAAAATTAAAAGAA
AAGGCAGGACTGTAAAATCAGAAATACCTTCTTTACAATATAGCAGACTAGATAATAATCTTCGTGTTAA
TGATAATTAAGACATTGACCACGCTCATCAGAAGGCTCGCCAGAATAAACGTTGCAAAAAGGATTCCTGG
AAAAATGGTCGCACACAAAAATTTAAAAATAAATCTATTTCTTCTTTTTTGTGTGTCCA

Friday, September 14, 2012

[Legendary] Egyptian Book Of The Dead


                                    2401 BC                                 
                                                                            
                               THE PAPYRUS OF ANI                           
                        (THE EGYPTIAN BOOK OF THE DEAD)                     
                                                                            
                        Translated by E.A. Wallis Budge                     
                                                                            
                                                                            
                                                                            
                                                                            
                                                                            
                                                                            
                                                                            
                                                                            
                                                                            
HYMN_TO_OSIRIS                                                              
  HYMN TO OSIRIS                                                            
-                                                                           
  "Homage to thee, Osiris, Lord of eternity, King of the Gods, whose        
names are manifold, whose forms are holy, thou being of hidden form in      
the temples, whose Ka is holy. Thou art the governor of Tattu               
(Busiris), and also the mighty one in Sekhem (Letopolis). Thou art the      
Lord to whom praises are ascribed in the nome of Ati, thou art the          
Prince of divine food in Anu. Thou art the Lord who is commemorated in      
Maati, the Hidden Soul, the Lord of Qerrt (Elephantine), the Ruler          
supreme in White Wall (Memphis). Thou art the Soul of Ra, his own           
body, and hast thy place of rest in Henensu (Herakleopolis). Thou           
art the beneficent one, and art praised in Nart. Thou makest thy            
soul to be raised up. Thou art the Lord of the Great House in               
Khemenu (Hermopolis). Thou art the mighty one of victories in               
Shas-hetep, the Lord of eternity, the Governor of Abydos. The path          
of his throne is in Ta-tcheser (a part of Abydos). Thy name is              
established in the mouths of men. Thou art the substance of Two             
Lands (Egypt). Thou art Tem, the feeder of Kau (Doubles), the Governor      
of the Companies of the gods. Thou art the beneficent Spirit among the      
spirits. The god of the Celestial Ocean (Nu) draweth from thee his          
waters. Thou sendest forth the north wind at eventide, and breath from      
thy nostrils to the satisfaction of thy heart. Thy heart reneweth           
its youth, thou producest the.... The stars in the celestial heights        
are obedient unto thee, and the great doors of the sky open themselves      
before thee. Thou art he to whom praises are ascribed in the                
southern heaven, and thanks are given for thee in the northern heaven.      
The imperishable stars are under thy supervision, and the stars             
which never set are thy thrones. Offerings appear before thee at the        
decree of Keb. The Companies of the Gods praise thee, and the gods          
of the Tuat (Other World) smell the earth in paying homage to thee.         
The uttermost parts of the earth bow before thee, and the limits of         
the skies entreat thee with supplications when they see thee. The holy      
ones are overcome before thee, and all Egypt offereth thanksgiving          
unto thee when it meeteth Thy Majesty. Thou art a shining Spirit-Body,      
the governor of Spirit-Bodies; permanent is thy rank, established is        
thy rule. Thou art the well-doing Sekhem (Power) of the Company of the      
Gods, gracious is thy face, and beloved by him that seeth it. Thy fear      
is set in all the lands by reason of thy perfect love, and they cry         
out to thy name making it the first of names, and all people make           
offerings to thee. Thou art the lord who art commemorated in heaven         
and upon earth. Many are the cries which are made to thee at the Uak        
festival, and with one heart and voice Egypt raiseth cries of joy to        
thee.                                                                       
  "Thou art the Great Chief, the first among thy brethren, the              
Prince of the Company of the Gods, the stablisher of Right and Truth        
throughout the World, the Son who was set on the great throne of his        
father Keb. Thou art the beloved of thy mother Nut, the mighty one          
of valour, who overthrew the Sebau-fiend. Thou didst stand up and           
smite thine enemy, and set thy fear in thine adversary. Thou dost           
bring the boundaries of the mountains. Thy heart is fixed, thy legs         
are set firm. Thou art the heir of Keb and of the sovereignty of the        
Two Lands (Egypt). He (Keb) hath seen his splendours, he hath               
decreed for him the guidance of the world by thy hand as long as times      
endure. Thou hast made this earth with thy hand, and the waters, and        
the winds, and the vegetation, and all the cattle, and all the              
feathered fowl, and all the fish, and all the creeping things, and all      
the wild animals therof. The desert is the lawful possession of the         
son of Nut. The Two Lands (Egypt) are content to crown thee upon the        
throne of thy father, like Ra.                                              
  "Thou rollest up into the horizon, thou hast set light over the           
darkness, thou sendest forth air from thy plumes, and thou floodest         
the Two Lands like the Disk at daybreak. Thy crown penetrateth the          
height of heaven, thou art the companion of the stars, and the guide        
of every god. Thou art beneficent in decree and speech, the favoured        
one of the Great Company of the Gods, and the beloved of the Little         
Company of the Gods.                                                        
  His sister [Isis] hath protected him, and hath repulsed the               
fiends, and turned aside calamities (of evil). She uttered the spell        
with the magical power of her mouth. Her tongue was perfect, and it         
never halted at a word. Beneficent in command and word was Isis, the        
woman of magical spells, the advocate of her brother. She sought him        
untiringly, she wandered round and round about this earth in sorrow,        
and she alighted not without finding him. She made light with her           
feathers, she created air with her wings, and she uttered the death         
wail for her brother. She raised up the inactive members of whose           
heart was still, she drew from him his essence, she made an heir,           
she reared the child in loneliness, and the place where he was not          
known, and he grew in strength and stature, and his hand was mighty in      
the House of Keb. The Company of the Gods rejoiced, rejoiced, at the        
coming of Horus, the son of Osiris, whose heart was firm, the               
triumphant, the son of Isis, the heir of Osiris."                           
                                                                            
REFERENCES                                                                  
  REFERENCES                                                                
-                                                                           
  Following is a list of frequently-mentioned geographical                  
locations, and their commonly-known names:                                  
     Abtu                   Abydos                                          
     Abu                    Elephantine                                     
     Anu                    Heliopolis                                      
     Bast                   Bubastis                                        
                                                   {REFERENCES ^paragraph 5}
     Hensu                  Herakleopolis                                   
     Het-ka-Ptah            Memphis                                         
     Khemenu                Hermopolis                                      
     Per-Menu               Panopolis                                       
     Qerrt                  Elephantine                                     
                                                  {REFERENCES ^paragraph 10}
     Sau                    Sais                                            
     Sekhem                 Letopolis                                       
     Suat                   Asyut                                           
     Tetu                   Busiris                                         
     Two Lands              Upper and Lower Egypt                           
                                                  {REFERENCES ^paragraph 15}
     Unu                    Hermopolis                                      
                                                                            
HYMN_TO_RA_THE_SUN_GOD                                                      
-                                                                           
  A HYMN OF PRAISE TO RA WHEN HE RISETH IN THE EASTERN PART OF HEAVEN:      
Behold, the Osiris Ani, the scribe of the holy offerings of all the         
gods, saith: Homage to thee, O thou who hast come as Khepera,               
Khepera the creator of the gods, Thou art seated on thy throne, thou        
risest up in the sky, illumining thy mother [Nut], thou art seated          
on thy throne as the king of the gods. [Thy] mother Nut stretcheth out      
her hands, and performeth an act of homage to thee. The domain of Manu      
receiveth thee with satisfaction. The goddess Maat embraceth thee at        
the two seasons of the day. May Ra give glory, and power, and               
thruth-speaking, and the appearance as a living soul so that he may         
gaze upon Heru-khuti, to the KA of the Osiris the Scribe Ani, who           
speaketh truth before Osiris, and who saith: Hail, O all ye gods of         
the House of the Soul, who weigh heaven and earth in a balance, and         
who give celestial food [to the dead]. Hail, Tatun, [who art] One,          
thou creator of mortals [and] of the Companies of the Gods of the           
South and of the North, of the West and of the East, ascribe ye praise      
to Ra, the lord of heaven, the KING, Life, Strength, and Health, the        
maker of the gods. Give ye thanks unto him in his beneficent form           
which is enthroned in the Atett Boat; beings celestial praise thee,         
beings terrestial praise thee. Thoth and the goddess Maat mark out thy      
course for thee day by day and every day. Thine enemy the Serpent hath      
been given over to the fire. The Serpent-fiend Sebau hath fallen            
headlong, his forelegs are bound in chains, and his hind legs hath          
Ra carried away from him. The Sons of Revolt shall never more rise up.      
The House of the Aged One keepeth festival, and the voices of those         
who make merry are in the Great Place. The gods rejoice when they           
see Ra crowned upon his throne, and when his beams flood the world          
with light. The majesty of this holy god setteth out on his journey,        
and he goeth onwards until he reacheth the land of Manu; the earth          
becometh light at his birth each day; he proceedeth until he                
reacheth the place where he was yesterday. O be thou at peace with me.      
Let me gaze upon thy beauties. Let me journey above the earth. Let          
me smite the Ass. Let me slit asunder the Serpent-fiend Sebau. Let          
me destroy Aepep at the moment of his greatest power. Let me behold         
the Abtu Fish at his season, and the Ant Fish with the Ant Boat as          
it piloteth it in its lake. Let me behold Horus when he is in charge        
of the rudder [of the Boat of Ra], with Thoth and the goddess Maat          
on each side of him. Let me lay hold of the tow-rope of the Sektet          
Boat, and the rope at the stern of the Matett Boat. Let Ra grant to me      
a view of the Disk (the Sun), and a sight of Ah (the Moon) unfailingly      
each day. Let my Ba-soul come forth to walk about hither and thither        
and whithersoever it pleaseth. Let my name be called out, let it be         
found inscribed on the tablet which recordeth the names of those who        
are to receive offerings. Let meals from the sepulchral offerings be        
given to me in the presence [of Osiris], as to those who are in the         
following of Horus. Let there be prepared for me a seat in the Boat of      
the Sun on the day wheron the god saileth. Let me be received in the        
presence of Osiris in the Land of Truth-speaking- the Ka of Osiris          
Ani.                                                                        
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nekht, Brit. Mus. No. 10471, Sheet 21)               
-                                                                           
  NEKHT, THE CAPTAIN OF SOLDIERS, THE ROYAL SCRIBE, SINGETH A HYMN          
OF PRAISE TO RA, and saith:- Homage to thee, O thou glorious Being,         
thou who art dowered [with all sovereignty]. O Tem-Heru-Khuti               
(Tem-Harmakhis), when thou risest in the horizon of heaven a cry of         
joy goeth forth to thee from all people. O thou beautiful Being,            
thou dost renew thyself in thy season in the form of the Disk,              
within thy mother Hathor. Therefore in every place every heart              
swelleth with joy at thy rising for ever. The regions of the South and      
the North come to thee with homage, and send forth acclamations at thy      
rising on the horizon of heaven, and thou illuminest the Two Lands          
with rays of turquoise-[coloured] light. O Ra, who art Heru-Khuti, the      
divine man-child, the heir of eternity, self-begotten and self-born,        
king of the earth, prince of the Tuat (the Other World), governor of        
Aukert, thou didst come from the Water-god, thou didst spring from the      
Sky-god Nu, who doth cherish thee and order thy members. O thou god of      
life, thou lord of love, all men live when thou shinest; thou art           
crowned king of the gods. The goddess Nut embraceth thee, and the           
goddess Mut enfoldeth thee at all seasons. Those who are in thy             
following sing unto thee with joy, and they bow down their foreheads        
to the earth when they meet thee, the lord of heaven, the lord of           
the earth, the King of Truth, the lord of eternity, the prince of           
everlastingness, thou sovereign of all the gods, thou god of life,          
thou creator of eternity, thou maker of heaven wherin thou art              
firmly stablished.                                                          
  The Company of the Gods rejoice at thy rising, the earth is glad          
when it beholdeth thy rays; the people who have been long dead come         
forth with cries of joy to behold thy beauties every day. Thou goest        
forth each day over heaven and earth, and thou art made strong each         
day be thy mother Nut. Thou passest over the heights of heaven, thy         
heart swelleth with joy; and the Lake of Testes (the Great Oasis) is        
content thereat. The Serpent-fiend hath fallen, his arms are hewn off,      
the Knife hath severed his joints. Ra liveth by Maat (Law), the             
beautiful! The Sektet Boat advanceth and cometh into port. The South        
and the North, and the West and East, turn to praise thee. O thou           
First, Great God (PAUTA), who didst come into being of thine own            
accord, Isis and Nephthys salute thee, they sing unto thee songs of         
joy at thy rising in the boat, they stretch out their hands unto thee.      
The Souls of the East follow thee, and the Souls of the West praise         
thee. Thou art the Ruler of all the gods. Thou in thy shrine hast joy,      
for the Serpent-fiend Nak hath been judged by the fire, and thy             
heart shall rejoice for ever. Thy mother Nut is esteemed by thy father      
Nu.                                                                         
                                                                            
HYMN_TO_OSIRIS_UN_NEFER                                                     
  HYMN TO OSIRIS UN-NEFER                                                   
-                                                                           
  A Hymn of Praise to Osiris Un-Nefer, the great god who dwelleth in        
Abtu, the king of eternity, the lord of everlastingness, who                
traverseth millions of years in his existence. Thou art the eldest son      
of the womb of Nut. Thou was begotten by Keb, the Erpat. Thou art           
the lord of the Urrt Crown. Thou art he whose White Crown is lofty.         
Thou art the King (Ati) of gods [and] men. Thou hast gained possession      
of the sceptre of rule, and the whip, and the rank and dignity of           
thy divine fathers. Thy heart is expanded with joy, O thou who art          
in the kingdom of the dead. Thy son Horus is firmly placed on thy           
throne. Thou hast ascended thy throne as the Lord of Tetu, and as           
the Heq who dwelleth in Abydos. Thou makest the Two Lands to                
flourish through Truth-speaking, in the presence of him who is the          
Lord to the Uttermost Limit. Thou drawest on that which hath not yet        
come into being in thy name of "Ta-her-sta-nef." Thou governest the         
Two Lands by Maat in thy name of "Seker." Thy power is wide-spread,         
thou art he of whom the fear is great in thy name of "Usar" (or             
"Asar"). Thy existence endureth for an infinite number of double henti      
periods in thy name of "Un-Nefer."                                          
  Homage to thee, King of Kings, and Lord of Lords, and Prince of           
Princes. Thou hast ruled the Two Lands from the womb of the goddess         
Nut. Thou hast governed the Lands of Akert. Thy members are of              
silver-gold, thy head is of lapis-lazuli, and the crown of thy head is      
of turquoise. Thou art An of millions of years. Thy body is all             
pervading, O Beautiful Face in Ta-tchesert. Grant thou to me glory          
in heaven, and power upon earth, and truth-speaking in the Divine           
Underworld, and [the power to] sail down the river to Tetu in the form      
of a living Ba-soul, and [the power to] sail up the river to Abydos in      
the form of a Benu bird, and [the power to] pass in through and to          
pass out from, without obstruction, the doors of the lords of the           
Tuat. Let there be given unto me bread-cakes in the House of                
Refreshing, and sepulchral offerings of cakes and ale, and                  
propitiatory offerings in Anu, and a permanent homestead in                 
Sekhet-Aaru, with wheat and barley therein- to the Double of the            
Osiris, the scribe Ani.                                                     
                                                                            
COMING_FORTH_BY_DAY                                                         
  THE CHAPTERS OF COMING FORTH BY DAY                                       
-                                                                           
  HERE BEGIN THE CHAPTERS OF COMING FORTH BY DAY, AND THE SONGS OF          
PRAISING AND GLORIFYING WHICH ARE TO BE RECITED FOR "COMING FORTH" AND      
FOR ENTERING INTO KHERT-NETER, AND THE SPELLS WHICH ARE TO BE SAID          
IN BEAUTIFUL AMENTET. THEY SHALL BE RECITED ON THE DAY OF THE FUNERAL,      
ENTERING IN AFTER COMING FORTH.                                             
-                                                                           
  The Osiris Ani, the Osiris the scribe Ani saith:- Homage to thee,         
O Bull of Amentet, Thoth the king of eternity is with me. I am the          
great god by the side of the divine boat, I have fought for thee, I am      
one of those gods, those divine chiefs, who proved the                      
truth-speaking of Osiris before his enemies on the day of the weighing      
of words. I am thy kinsman Osiris. I am [one of] those gods who were        
the children of the goddess Nut, who hacked in pieces the enemies of        
Osiris, and who bound in fetters the legion of Sebau devils on his          
behalf. I am thy kinsman Horus, I have fought on thy behalf, I have         
come to thee for thy name's sake. I am Thoth who proved the truth of        
the words of Osiris before his enemies on the day of the weighing of        
words in the great House of the Prince, who dwelleth in Anu. I am           
Teti, the son of Teti. My mother conceived me in Tetu, and gave             
birth to me in Tetu. I am with the mourners [and with] the women who        
tear out their hair and make lament for Osiris in Taui-Rekhti, proving      
true the words of Osiris before his enemies. Ra commanded Thoth to          
prove true the words of Osiris before his enemies; what was                 
commanded [for Osiris], let that be done for me by Thoth. I am with         
Horus on the day of dressing Teshtesh. I open the hidden water-springs      
for the ablutions of Urt-ab. I unbolt the door of the Shetait Shrine        
in Ra-stau. I am with Horus as the protector of the left shoulder of        
Osiris, the dweller in Sekhem. I enter in among and I come forth            
from the Flame-gods on the day of the destruction of the Sebau              
fiends in Sekhem. I am with Horus on the day[s] of the festivals of         
Osiris, at the making of offerings and oblations, namely, on the            
festival which is celebrated on the sixth day of the month, and on the      
day of the Tenat festival in Anu. I am the UAB priest (libationer)          
in Tetu, Rera, the dweller in Per-Asar. I exalt him that is upon the        
high place of the country. I look upon the hidden things (the               
mysteries) in Ra-stau. I recite the words of the liturgy of the             
festival of the Soul-god in Tetu. I am the SEM priest, and [perform]        
his duties. I am the UR-KHERP-HEM priest on the day of placing the          
Henu Boat of Seker upon its divine sledge. I have taken in my hand the      
digging tool on the day of digging up the earth in Hensu.                   
  Hail, O ye who make perfect souls to enter into the House of Osiris,      
make ye the well-instructed soul of the Osiris the scribe Ani, whose        
word is true, to enter in and to be with you in the House of Osiris.        
Let him hear even as ye hear; let him have sight even as ye have            
sight; let him stand up even as ye stand up; let him take his seat          
even as ye take your seats.                                                 
  Hail, O ye who give cakes and ale to perfect souls in the House of        
Osiris, give ye cakes and ale twice each day (in the morning and in         
the evening) to the soul of the Osiris Ani, whose word is true              
before the gods, the Lords of Abydos, and whose word is true with you.      
                                          {COMING_FORTH_BY_DAY ^paragraph 5}
  Hail, O ye who open up the way, who act as guides to the roads [in        
the Other World] to perfect souls in the House of Osiris, open ye up        
for him the way, and act ye as guides to the roads to the soul of           
the Osiris, the scribe, the registrary of all the offerings made to         
the gods, Ani, [whose word is true] with you. May he enter the House        
of Osiris with boldness, and may he come forth therefrom in peace. May      
there be no opposition made to him, and may he not be sent back             
[therefrom]. May he enter in under favour [of Osiris], and may he come      
forth gratified [at the acceptance of] his true words. May his              
commands be performed in the House of Osiris, may his words travel          
with you, may he be glorious as ye are. May he be not found to be           
light in the Balance, may the Balance dispose of his case.                  
-                                                                           
-                                                                           
  (In the Turin Papyrus, ed. Lepsius, this Chapter ends with the            
following.)                                                                 
-                                                                           
  Permit thou not me to be judged according to the mouths of the            
multitude. May my soul lift itself up before [Osiris], having been          
found to have been pure when on earth. May I come into thy presence, O      
Lord of the gods; may I arrive at the Nome of Maati (Truth); may I          
rise up on my seat like a god endowed with life; may I give forth           
light like the Company of the Gods who dwell in heaven; may I become        
like one of you; may I lift up my footsteps in the town of Kher-Aha;        
may I look upon the Sektet Boat of the god, Saah, the holy one, as          
it passeth across the sky; may I not be repulsed; may I look upon           
the Lords of the Tuat, or, according to another reading, the Company        
of the Gods; may I smell the savour of the divine food of the               
Company of the Gods; may I sit down with them; may my name be               
proclaimed for offerings by the KHER-HEB priest at the sacrificial          
table; may I hear the petitions which are made when offerings are           
presented; may I draw nigh unto the Neshem Boat; and may neither my         
Heart-soul nor its lord be repulsed.                                        
                                         {COMING_FORTH_BY_DAY ^paragraph 10}
  Homage to thee, O Chief of Amentet, thou god Osiris, who dwellest in      
the town of Nifu-ur. Grant thou that I may arrive in peace in Amentet.      
May the Lords of Ta-Tchesert receive me, and may they say unto me:          
"Hail, hail; welcome, welcome!" May they make ready for me a seat by        
the side of the President of the Chiefs; may the Nursing-goddesses          
receive me at the seasons, and may I come forth into the presence of        
Un-Nefer true of word. May I be a Follower of Horus in Ra-stau, and of      
Osiris in Tetu; and may I perform all the transformations which my          
heart may desire to make in every place wherein my Double (KA) wisheth      
to be.                                                                      
-                                                                           
  RUBRIC: If this text be known [by the deceased] upon earth or if          
he causeth it to be done in writing upon [his] coffin, then will he be      
able to come forth on any day he pleaseth, and to enter into his            
habitation unrepulsed. Cakes and ale and joints of meat from those          
which are on the altar of Ra shall be given unto him, and his               
homestead shall be among the fields of the Field of Reeds                   
(Sekhet-Aaru), and wheat and barley shall be given unto him therein,        
and he shall flourish there even as he flourished upon earth.               
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nekhtu-Amen, ed. Naville, I, 5)                      
-                                                                           
  THE CHAPTER OF MAKING THE SAHU TO ENTER THE TUAT ON THE DAY OF THE        
FUNERAL, WHEN THE FOLLOWING WORDS ARE TO BE SAID: Homage to thee, O         
thou who dwellest in the Holy Hill (Set-Tchesert) of Amentet! the           
Osiris, the royal scribe, Nekhtu-Amen, whose word is true, knoweth          
thee, he knoweth thy name. Deliver thou him from the worms which are        
in Ra-stau, which live upon the bodies of men and women, and feed upon      
their blood, for Osiris, the favoured servant of the god of his             
city, the royal scribe Nekhtu-Amen, knoweth you, and he knoweth your        
names. Let the order for his protection be the first command of             
Osiris, the Lord to the Uttermost Limit, who keepeth his body               
hidden. May he give him release from the Terrible One who dwelleth          
at the bend of the River of Amentet, and may he decree the acts that        
will make him to rise up. Let him pass on to him whose throne is            
placed within the darkness, who giveth light in Ra-stau. O thou Lord        
of Light, come thou and swallow up the worms which are in Amentet. Let      
the Great God who dwelleth in Tetu, and who is himself unseen, hear         
his prayers, and let those who cause afflictions hold him in fear as        
he cometh forth with the sentence of their doom to the Divine Block. I      
the Osiris, the royal scribe, Nekhtu-Amen, come, bearing the decree of      
Neb-er-tcher, and I am the Horus who taketh possession of his throne        
for him. His father, the lord of all those who are in the Boat of           
his Father Horus, hath ascribed praise unto him. He cometh bearing          
tidings....... let him see the town of Anu. Their chief shall stand on      
the earth before him, the scribes shall magnify him at the doors of         
their assemblies, and thy shall swathe im with swathings in Anu. He         
hath led heaven captive, and he hath seized the earth in his grasp.         
Neither the heavens nor the earth can be taken away from him, for,          
behold, he is Ra, the firstborn of the gods. His mother shall nurse         
him, and shall give him her breast on the horizon.                          
-                                                                           
  RUBRIC: The words of this Chapter shall be said after [the deceased]      
is laid to rest in Amentet; by means of them the region Tenn-t shall        
be contented with her lord. And the Osiris, the royal scribe,               
Nekhtu-Amen, whose word is truth, shall come forth, and he shall            
embark in the Boat of Ra, and [his] body upon its bier shall be             
counted up, and he shall be established in the Tuat.                        
                                                                            
GIVING_A_MOUTH_TO_ANI                                                       
-                                                                           
  THE CHAPTER OF GIVING A MOUTH TO THE OSIRIS ANI, THE SCRIBE, AND          
TELLER OF THE OFFERINGS WHICH ARE MADE TO ALL THE GODS, WHOSE WORD          
IS TRUE, WHO SAITH:- I rise up out of the Egg in the Hidden Land.           
May my mouth be given unto me that I may speak therewith in the             
presence of the Great God, the Lord of the Tuat. Let not my hand and        
my arm be repulsed in the presence of the Chiefs (Tchatchau) of any         
god. I am Osiris, the Lord of Ra-stau. May I, the Osiris, the scribe        
Ani, whose word is true, have my portion with him who is on the top of      
the Steps (Osiris). According to the desire of my heart I have come         
forth from the Island of Nesersert, and I have extinguished the fire.       
                                                                            
GIVING_A_MOUTH_TO_ANI|APPENDIX                                              
  APPENDIX                                                                  
  [The following passage is taken from the Saite Recension]                 
-                                                                           
  [THE CHAPTER OF GIVING A MOUTH TO THE OSIRIS, THE SCRIBE ANI, WHO         
SAITH]:- Homage to thee, O thou lord of brightness, Governor of the         
Temple, Prince of the night and of the thick darkness. I have come          
unto thee. I am shining, I am pure. My hands are about thee, thou hast      
thy lot with thy ancestors. Give thou unto me my mouth that I may           
speak with it. I guide my heart at its season of flame and of night.        
-                                                                           
  RUBRIC: If this Chapter be known by the Osiris the scribe Ani,            
upon earth, [or if it be done] in writing upon [his] coffin, he             
shall come forth by day in every form which he pleaseth, and he             
shall enter into [his] abode, and shall not be repulsed. And cakes,         
and ale, and joints of meat [from those which are on] the altar of          
Osiris shall be given unto him; and he shall enter in peace into            
Sekhet-Aaru, conformably to the decree of the Dweller in Busiris.           
Wheat and barley (dhura) shall be given unto him therein, and he shall      
flourish there just as he did upon earth; and he shall do whatsoever        
it pleaseth him to do, even as do the Company of the Gods who are in        
the Tuat, regularly and continually, for millions of times.                 
-                                                                           
-                                                                           
                               {GIVING_A_MOUTH_TO_ANI|APPENDIX ^paragraph 5}
  (From the Paprys of Nebseni, Sheet 3)                                     
-                                                                           
  THE CHAPTER OF COMING FORTH BY DAY AND OF OPENING UP A WAY THROUGH        
THE AMEHET: Behold, the scribe Nebseni, whose word is truth, saith:-        
Homage to you, O ye Lords of Kau, ye who are without sin, and who live      
for the endless and infinite aeons of time which make up eternity. I        
have opened up a way for myself to you. I have become a spirit in my        
forms, I have gotten the mastery over my words of magical power, and I      
am adjudged a spirit; therefore deliver ye me from the Crocodile            
[which liveth in] this Country of Truth. Grant ye to me my mouth            
that I may speak therewith, and cause ye that sepulchral offerings          
shall be made unto me in your presence, for I know you, and I know          
your names, and I know also the name of the mighty god before whose         
face ye set your celestial food. His name is "Tekem." [When] he             
openeth up his path on the eastern horizon of heaven, [when] he             
alighteth towards the western horizon of heaven, may he carry me along      
with him, and may I be safe and sound. Let not the Mesqet make an           
end of me, let not the Fiend (Sebau) gain the mastery over me, let          
me not be driven away from the doors of the Other World, let not you        
doors be shut in my face, for my cakes are in the city of Pe, and my        
ale is in the city of Tep. And there, in the celestial mansions of          
heaven which my divine father Tem hath stablished, let my hands lay         
hold upon the wheat and the barley, which shall be given unto me            
therein in abundant measure, and may the son of my own body make ready      
for me my food therein. And grant ye unto me when I am there                
sepulchral meals, and incense, and unguents, and all the pure and           
beautiful things whereon the god liveth, in every deed for ever, in         
all the transformations which it pleaseth me [to perform], and grant        
unto me the power to float down and to sail up the stream in the Field      
of Reeds (Sekhet-Aaru), [and may I reach Sekhet-hetepet (the Field          
of Offerings)]. I am the twin Lion-gods (Shu and Tefnut).                   
                                                                            
WEIGHING_OF_THE_HEART_OF_ANI                                                
  TEXTS RELATING TO THE WEIGHING OF THE HEART OF ANI                        
-                                                                           
  THE NAMES OF THE GODS OF THE GREAT COMPANY:- 1. Ra Harmakhis, the         
Great God in his boat. 2. Temu. 3. Shu. 4. Tefnut. 5. Keb. 6. Nut, the      
Lady of Heaven. 7. Isis. 8. Nephthys. 9. Horus, the Great God. 10.          
Hathor, Lady of Amentet. 11. Hu. 12. Sa.                                    
-                                                                           
  THE PRAYER OF ANI:- My heart, my mother; my heart, my mother! My          
heart whereby I came into being! May nought stand up to oppose me at        
[my] judgment, may there be no opposition to me in the presence of the      
Chiefs (Tchatchau); may there be no parting of thee from me in the          
presence of him that keepeth the Balance! Thou art my KA, which             
dwelleth in my body; the god Khnemu who knitteth together and               
strengtheneth my limbs. Mayest thou come forth into the place of            
happiness whither we go. May the Sheniu officials, who make the             
conditions of the lives of men, not cause my name to stink, and may no      
lies be spoken against me in the presence of the God. [Let it be            
satisfactory unto us, and let the Listener god be favourable unto           
us, and let there be joy of heart (to us) at the weighing of words.         
Let not that which is false be uttered against me before the Great          
God, the Lord of Amentet. Verily, how great shalt thou be when thou         
risest in triumph.]                                                         
-                                                                           
  THE SPEECH OF THOTH:- Thoth, the judge of right and truth of the          
Great Company of the Gods who are in the presence of Osiris, saith:         
Hear ye this judgment. The heart of Osiris hath in very truth been          
weighed, and his Heart-soul hath borne testimony on his behalf; his         
heart hath been found right by the trial in the Great Balance. There        
hath not been found any wickedness in him; he hath not wasted the           
offerings which have been made in the temples; he hath not committed        
any evil act; and he hath not set his mouth in motion with words of         
evil whilst he was upon earth.                                              
                                 {WEIGHING_OF_THE_HEART_OF_ANI ^paragraph 5}
-                                                                           
  SPEECH OF THE DWELLER IN THE EMBALMMENT CHAMBER (ANUBIS):- Pay            
good heed, O righteous Judge to the Balance to support [the testimony]      
thereof. Variant: Pay good heed to the weighing in the Balance of           
the heart of the Osiris, the singing-woman of Amen, Anhai, whose            
word is truth, and place thou her heart in the seat of truth in the         
presence of the Great God.                                                  
-                                                                           
  THE SPEECH OF THE GODS:- The Great Company of the Gods say to             
Thoth who dwelleth in Khemenu: That which cometh forth from thy             
mouth shall be declared true. The Osiris the scribe Ani, whose word is      
true, is holy and righteous. He hath not committed any sin, and he          
hath done no evil against us. The devourer Am-mit shall not be              
permitted to prevail over him. Meat offerings and admittance into           
the presence of the god Osiris shall be granted unto him, together          
with an abiding habitation in the Field of Offerings (Sekhet-hetepet),      
as unto the Followers of Horus.                                             
-                                                                           
                                {WEIGHING_OF_THE_HEART_OF_ANI ^paragraph 10}
  THE SPEECH OF HORUS TO OSIRIS IN INTRODUCING ANI TO HIM:- Horus, the      
son of Isis, saith: I have come to thee, O Un-Nefer, and I have             
brought unto thee the Osiris Ani. His heart is righteous, and it            
hath come forth from the Balance; it hath not sinned against any god        
or any goddess. Thoth hath weighed it according to the decree               
pronounced unto him by the Company of the Gods, and it is most true         
and righteous. Grant thou that cakes and ale may be given unto him,         
and let him appear in the presence of the god Osiris, and let him be        
like unto the Followers of Horus for ever and ever.                         
-                                                                           
  THE SPEECH OF ANI:- And the Osiris Ani saith: Behold, I am in thy         
presence, O Lord of Amentet. There is no sin in my body. I have not         
spoken that which is not true knowingly, nor have I done anything with      
a false heart. Grant thou that I may be like unto those favoured            
ones who are in thy following, and that I may be an Osiris greatly          
favoured of the beautiful god, and beloved of the Lord of the Two           
Lands, I who am a veritable royal scribe who loveth thee, Ani, whose        
word is true before the god Osiris.                                         
-                                                                           
  DESCRIPTION OF THE BEAST AM-MIT:- Her forepart is like that of a          
crocodile, the middle of her body is like that of a lion, her hind          
quarters are like those of a hippopotamus.                                  
                                                                            
PRAISES_AND_GLORIFYINGS                                                     
-                                                                           
  HERE BEGIN THE PRAISES AND GLORIFYINGS OF COMING OUT FROM AND OF          
GOING INTO THE GLORIOUS KHERT-NETER, WHICH IS IN THE BEAUTIFUL              
AMENTET, OF COMING FORTH BY DAY IN ALL THE FORMS OF EXISTENCE WHICH IT      
MAY PLEASE THE DECEASED TO TAKE, OF PLAYING AT DRAUGHTS, OF SITTING IN      
THE SEH HALL, AND OF APPEARING AS A LIVING SOUL:                            
  The Osiris the scribe Ani saith after he hath arrived in his haven        
of rest- now it is good for [a man] to recite [this work whilst he is]      
upon earth, for then all the words of Tem come to pass-                     
-                                                                           
  "I am the god Tem in rising. I am the Only One. I came into               
existence in Nu. I am Ra who rose in the beginning, the ruler of            
this [creation]."                                                           
-                                                                           
  Who is this?                                                              
                                      {PRAISES_AND_GLORIFYINGS ^paragraph 5}
-                                                                           
  "It is Ra, when at the beginning he rose in the city of Hensu,            
crowned like a king for his coronation. The Pillars of the god Shu          
were not as yet created, when he was upon the steps of him that             
dwelleth in Khemenu.                                                        
  "I am the Great God who created himself, even Nu, who made his names      
to become the Company of the Gods as gods."                                 
-                                                                           
  Who is this?                                                              
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 10}
-                                                                           
  "It is Ra, the creator of the names of his limbs, which came into         
being in the form of the gods who are in the train of Ra.                   
  "I am he who cannot be repulsed among the gods."                          
-                                                                           
  Who is this?                                                              
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 15}
-                                                                           
  "It is Temu, the dweller in his disk, but others say that it is Ra        
when he riseth in the eastern horizon of the sky.                           
  "I am Yesterday, I know To-day."                                          
-                                                                           
  Who is this?                                                              
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 20}
-                                                                           
  "Yesterday is Osiris, and To-day is Ra, when he shall destroy the         
enemies of Neb-er-tcher (the lord to the uttermost limit), and when he      
shall establish as prince and ruler his son Horus.                          
  "Others, however, say that To-day is Ra, on the day when we               
commemorate the festival of the meeting of the dead Osiris with his         
father Ra, and when the battle of the gods was fought, in which             
Osiris, the Lord of Amentet, was the leader."                               
-                                                                           
  What is this?                                                             
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 25}
-                                                                           
  "It is Amentet, [that is to say] the creation ofthe souls of the          
gods when Osiris was leader in Set-Amentet.                                 
  "Others, however, say that it is the Amentet which Ra hath given          
unto me; when any god cometh he must rise up and fight for it.              
  "I know the god who dwelleth therein."                                    
-                                                                           
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 30}
  Who is this?                                                              
-                                                                           
  "It is Osiris. Others, however, say that his name is Ra, and that         
the god who dwelleth in Amentet is the phallus of Ra, wherewith he had      
union with himself.                                                         
  "I am the Benu bird which is in Anu. I am the keeper of the volume        
of the book (the Tablet of Destiny) of the things which have been           
made, and of the things which shall be made."                               
-                                                                           
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 35}
  Who is this?                                                              
-                                                                           
  "It is Osiris.                                                            
  "Others, however, say that it is the dead body of Osiris, and yet         
others say that it is the excrement of Osiris. The things which have        
been made, and the things which shall be made [refer to] the dead body      
of Osiris. Others again say that the things which have been made are        
Eternity, and the things which shall be made are Everlastingness,           
and that Eternity is the Day, and Everlastingness the Night.                
  "I am the god Menu in his coming forth; may his two plumes be set on      
my head for me."                                                            
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 40}
-                                                                           
  Who is this?                                                              
-                                                                           
  "Menu is Horis, the Advocate of his father [Osiris], and his              
coming forth means his birth. The two plumes on his head are Isis           
and Nephthys, when these goddesses go forth and set themselves              
thereon, and when they act as his protectors, and when they provide         
that which his head lacketh.                                                
  "Others, however, say that the two plumes are the two exceedingly         
large uraei which are upon the head of their father Tem, and there are      
yet others who say that the two plumes which are upon the head of Menu      
are his two eyes.                                                           
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 45}
  "The Osiris the scribe Ani, whose word is true, the registrar of all      
the offerings which are made to the gods, riseth up and cometh into         
his city."                                                                  
-                                                                           
  What is this [city]?                                                      
-                                                                           
  "It is the horizon of his father Tem.                                     
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 50}
  "I have made an end of my shortcomings, and I have put away my            
faults."                                                                    
-                                                                           
  What is this?                                                             
-                                                                           
  "It is the cutting of the navel string of the body of the Osiris the      
scribe Ani, whose word is true before all the gods, and all his faults      
are driven out.                                                             
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 55}
-                                                                           
  What is this ?                                                            
-                                                                           
  "It is the purification [of Osiris] on the day of his birth.              
  "I am purified in my great double nest which is in Hensu on the           
day of the offerings of the followers of the Great God who dwelleth         
therein."                                                                   
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 60}
-                                                                           
  What is the "great double nest"?                                          
-                                                                           
  "The name of one nest is 'Millions of years,' and 'Great Green            
[Sea]' is the name of the other, that is to say 'Lake of Natron' and        
'Lake of Salt.'                                                             
  "Others, however, say the name of the one is 'Guide of Millions of        
Years,' and that 'Great Green Lake' is name of the other. Yet others        
say that 'Begetter of Millions of Years' is the name of one, and            
'Great Green Lake' is the name of the other. Now, as concerning the         
Great God who dwelleth therein, it is Ra himself.                           
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 65}
  "I pass over the way, I know the head of the Island of Maati."            
-                                                                           
  What is this?                                                             
-                                                                           
  "It is Ra-stau, that is to say, it is the gate to the South of            
Nerutef, and it is the Northern Gate of the Domain (Tomb of the god).       
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 70}
  "Now, as concerning the Island of Maati, it is Abtu.                      
  "Others, however, say that it is the way by which Father Tem              
travelleth when he goeth forth to Sekhet-Aaru, [the place] which            
produceth the food and sustenance of the gods who are [in] their            
shrines.                                                                    
  "Now the Gate Tchesert is the Gate of the Pillars of Shu, that is to      
say, the Northern Gate of the Tuat.                                         
  "Others, however, say that the Gate of Tchesert is the two leaves of      
the door through which the god Tem passeth when he goeth forth to           
the eastern horizon of the sky.                                             
  "O ye gods who are in the presence [of Osiris], grant to me your          
arms, for I am the god who shall come into being among you."                
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 75}
-                                                                           
  Who are these gods?                                                       
-                                                                           
  "They are the drops of blood which came forth from the phallus of Ra      
when he went forth to perform his own mutilitation. These drops of          
blood sprang into being under the forms of the gods Hu and Sa, who are      
in the bodyguard of Ra, and who accompany the god Tem daily and             
every day.                                                                  
  "I, Osiris the scribe Ani, whose word is truth, have filled for thee      
the utchat (the Eye of Ra, or of Horus), when it had suffered               
extinction on the day of the combat of the Two Fighters (Horus and          
Set)."                                                                      
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 80}
-                                                                           
  What was this combat?                                                     
-                                                                           
  It was the combat which took place on the day when Horus fought with      
Set, during which Set threw filth in the face of Horus, and Horus           
crushed the genitals of Set. The filling of the utchat Thoth performed      
with his own fingers.                                                       
  "I remove the thunder-cloud from the sky when there is a storm            
with thunder and lightning therein."                                        
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 85}
-                                                                           
  What is this?                                                             
-                                                                           
  "This storm was the raging of Ra at the thunder-cloud which [Set]         
sent forth against the Right Eye of Ra (the Sun). Thoth removed the         
thunder-cloud from the Eye of Ra, and brought back the Eye living,          
healthy, sound, and with no defect in it to its owner.                      
  "Others, however, say that the thunder-cloud is caused by sickness        
in the Eye of Ra, which weepeth for its companion Eye (the Moon); at        
this time Thoth cleanseth the Right Eye of Ra.                              
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 90}
  "I behold Ra who was born yesterday from the thighs of the goddess        
Mehurt; his strength is my strength, and my strength is his strength."      
-                                                                           
  Who is this?                                                              
-                                                                           
  "Mehurt is the great Celestial Water, but others say that Mehurt          
is the image of the Eye of Ra at dawn at his birth daily.                   
                                     {PRAISES_AND_GLORIFYINGS ^paragraph 95}
  "[Others, however, say that] Mehurt is the utchat of Ra.                  
  "Now Osiris the scribe Ani, whose word is truth, is a very great one      
among the gods who are in the following of Horus; they say that he          
is the prince who loveth his lord."                                         
-                                                                           
  Who are the gods who are in the train of Horus?                           
-                                                                           
                                    {PRAISES_AND_GLORIFYINGS ^paragraph 100}
  "[They are] Kesta, Hapi, Taumutef, and Qebhsenuf.                         
  "Homage to you, O ye lords of right and truth, ye sovereign               
princes (Tchatcha) who [stand] round about Osiris, who do away utterly      
sins and offences, and who are in the following of the goddess              
Hetepsekhus, grant ye that I may come unto you. Destroy ye all the          
faults which are within me, even as ye did for the Seven Spirits who        
are among the followers of their lord Sepa. Anpu (Anubis) appointed to      
them their places on the day [when he said unto them], "Come ye             
hither."                                                                    
-                                                                           
  Who are the "lords of right and truth"?                                   
-                                                                           
                                    {PRAISES_AND_GLORIFYINGS ^paragraph 105}
  "The lords of right and truth are Thoth and Astes, the Lord of            
Amentet.                                                                    
  "The Tchatcha round about Osiris are Kesta, Hapi, Tuamutef, and           
Qebhsenuf, and they are also round about the Constellation of the           
Thigh (the Great Bear), in the northern sky.                                
  "Those who do away utterly sins and offences, and who are in the          
following of the goddess Hetepsekhus, are the god Sebek and his             
associates who dwell in the water.                                          
  "The goddess Hetepsekhus is the Eye of Ra.                                
  "Others, however, say that it is the flame which accompanieth Osiris      
to burn up the souls of his enemies.                                        
                                    {PRAISES_AND_GLORIFYINGS ^paragraph 110}
  "As concerning all the faults which are in Osiris, the registrar          
of the offerings which are made unto all the gods, Ani, whose word          
is truth, [these are all the offences which he hath committed               
against the Lords of Eternity] since he came forth from his mother's        
womb.                                                                       
  "As concerning the Seven Spirits who are Kesta, Hapi, Tuamutef,           
Qebhsenuf, Maa-atef, Kheribeqef and Heru-khenti-en-ariti, these did         
Anubis appoint to be protectors of the dead body of Osiris.                 
  "Others, however, say that he set them round about the holy place of      
Osiris.                                                                     
  "Others say that the Seven Spirits [which were appointed by               
Anubis] were Netcheh-netcheh, Aatqetqet, Nertanef-besef-khenti-hehf,        
Aq-her-ami-unnut-f, Tesher-ariti-ami-Het-anes,                              
Ubes-her-per-em-khetkhet, and Maaem-kerh-annef-em-hru.                      
  "The chief of the Tchatcha (sovereign princes) who is in Naarutef is      
Horus, the Advocate of his father.                                          
                                    {PRAISES_AND_GLORIFYINGS ^paragraph 115}
  "As concerning the day wherein [Anubis said to the Seven Spirits],        
'Come ye hither,' [the allusion here] is to the words 'Come ye              
hither,' which Ra spake unto Osiris."                                       
-                                                                           
  Verily may these same words be said unto me in Amentet.                   
-                                                                           
  "I am the Divine Soul which dwelleth in the Divine Twin-gods."            
                                    {PRAISES_AND_GLORIFYINGS ^paragraph 120}
-                                                                           
  Who is this Divine Soul?                                                  
-                                                                           
  "It is Osiris. [When] he goeth into Tetu, and findeth there the Soul      
of Ra, the one god embraceth the other, and two Divine Souls spring         
into being within the Divine Twin-gods."                                    
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nebseni, Brit. Mus. No. 9900, Sheet 14, ll.          
16ff.)                                                                      
-                                                                           
  "As concerning the Divine Twin-gods they are Heru-netch-her-tefef         
and Heru-khent-en-Ariti (Horus the Advocate of his father [Osiris],         
and Horus the sightless).                                                   
  "Others say that the double Divine Soul which dwelleth in the Divine      
Twin-gods is the Soul of Ra and the Soul of Osiris, and yet others say      
that it is the Soul which dwelleth in Shu, and the Sould which              
dwelleth in Tefnut, and that these two Souls form the double Divine         
Soul which dwelleth in Tetu.                                                
  "I am the Cat which fought near the Persea Tree in Anu on the             
night when the foes of Neb-er-tcher were destroyed."                        
-                                                                           
                                                     {APPENDIX ^paragraph 5}
  Who is this Cat?                                                          
-                                                                           
  "This male Cat is Ra himself, and he was called 'Mau' because of the      
speech of the god Sa, who said concerning him: 'He is like (mau)            
unto that which he hath made'; therefore, did the name of Ra become         
'Mau.'                                                                      
  "Others, however, say that the male Cat is the god Shu, who made          
over the possessions of Keb to Osiris.                                      
  "As concerning the fight which took place near the Persea Tree in         
Anu [these words have reference to the slaughter] of the children of        
rebellion, when righteous retribution was meted out to them for [the        
evil] which they had done.                                                  
                                                    {APPENDIX ^paragraph 10}
  "As concerning the 'night of the battle,' [these words refer to] the      
invasion of the eastern portion of the heaven by the children of            
rebellion, whereupon a great battle arose in heaven and in all the          
earth.                                                                      
  "O thou who art in thine egg (Ra,) who showest from thy Disk, who         
risest on thy horizon, and dost shine with golden beams in the              
height of heaven, like unto whom there is none among the gods, who          
sailest above the Pillars of Shu, who sendest forth blasts of fire          
from thy mouth, [who illuminest the Two Lands with thy splendour,           
deliver] thou Nebseni, the lord of fealty [to Osiris], from the god         
whose form is hidden, and whose eyebrows are like unto the two arms of      
the Balance on the night when the sentences of doom are promulgated."       
-                                                                           
  Who is this invisible god?                                                
-                                                                           
                                                    {APPENDIX ^paragraph 15}
  "It is An-a-f (he who bringeth his arm.).                                 
  "As concerning 'the night when the sentences of doom are                  
promulgated,' it is the night of the burning of the damned, and of the      
overthrow of the wicked at the Block, and of the slaughter of souls."       
-                                                                           
  Who is this [slaughterer of souls]?                                       
-                                                                           
                                                    {APPENDIX ^paragraph 20}
  "It is Shesmu, the headsman of Osiris.                                    
  "[Concerning the invisible god] some say that he is Aapep when he         
riseth up with a head bearing upon it [the feather of] Maat (Truth).        
But others say that he is Horus when he riseth up with two heads,           
whereon one beareth [the feather of] Maat, and the other [the symbol        
of] wickedness. He bestoweth wickedness on him that worketh                 
wickedness, and right and truth upon him that followeth                     
righteousness and truth.                                                    
  "Others say that he is Heru-ur (the Old Horus), who dwelleth in           
Sekhem; others say that he is Thoth; others say that he is                  
Nefer-Tem; and others say that he is Sept who doth bring to nought the      
acts of the foes of Nebertcher.                                             
  "Deliver thou the scribe Nebseni, whose word is truth, from the           
Watchers, who carry murderous knives, who possess cruel fingers, and        
who would slay those who are in the following of Osiris."                   
  May these Watchers never gain the mastery over me, and may I never        
fall under their knives!                                                    
                                                    {APPENDIX ^paragraph 25}
-                                                                           
  Who are these Watchers?                                                   
-                                                                           
  "They are Anubis and Horus, [the latter being] in the form of             
Horus the sightless. Others, however, say that they are the Tchatcha        
(sovereign princes of Osiris), who bring to nought the operations of        
their knives; and others say that they are the chiefs of the Sheniu         
chamber.                                                                    
  "May their knives never gain the mastery over me. May I never fall        
under the knives wherewith they inflict cruel tortures. For I know          
their names, and I know the being, Matchet, who is among them in the        
House of Osiris. He shooteth forth rays of light from his eye, being        
himself invisible, and he goeth round about heaven robed in the flames      
which come from his mouth, commanding Hapi, but remaining invisible         
himself. May I be strong on earth before Ra, may I arrive safely in         
the presence of Osiris. O ye who preside over your altars, let not          
your offerings to me be wanting, for I am one of those who follow           
after Nebertcher, according to the writings of Khepera. Let me fly          
like a hawk, let me cackle like a goose, let me lay always like the         
serpent-goddess Neheb-ka."                                                  
                                                    {APPENDIX ^paragraph 30}
-                                                                           
  Who are those who preside over their altars?                              
-                                                                           
  "Those who preside over their altars are the similitude of the Eye        
of Ra, and the similitude of the Eye of Horus.                              
  "O Ra-Tem, thou Lord of the Great House [in Anu], thou Sovereign          
(life, strentgh, health [be to thee]) of all the gods, deliver thou         
the scribe Nebseni, whose word is truth, from the god whose face is         
like unto that of a greyhound, whose brows are like those of a man,         
who feedeth upon the dead, who watcheth at the Bend of the Lake of          
Fire, who devoureth the bodies of the dead, and swalloweth hearts, and      
who voideth filth, but who himself remaineth unseen."                       
                                                    {APPENDIX ^paragraph 35}
-                                                                           
  Who is this greyhound-faced god?                                          
-                                                                           
  "His name is 'Everlasting Devourer,' and he liveth in the Domain [of      
Fire] (the Lake of Unt).                                                    
  "As concerning the Domain of Fire, it is that Aat which is in             
Naarutef, and is near the Sheniu chamber. The sinner who walketh            
over this place falleth down among the knives [of the Watchers].            
                                                    {APPENDIX ^paragraph 40}
  "Others, however, say that the name of this god is 'Mates,' and that      
he keepeth watch over the door of Amentet; others say that his name is      
'Beba,' and that he keepeth watch over the Bend [of the stream] of          
Amentet, and yet others say that his name is 'Herisepef.'                   
  "Hail, Lord of Terror, Chief of the Lands of the South and North,         
thou Lord of the Desert, who dost keep prepared the block of                
slaughter, and who dost feed on the intestines [of men]!"                   
-                                                                           
  Who is this Lord of Terror?                                               
-                                                                           
                                                    {APPENDIX ^paragraph 45}
  "It is the Keeper of the Bend [of the stream] of Amentet."                
-                                                                           
  Who is this Keeper?                                                       
-                                                                           
  "It is the Heart of Osiris, which is the devourer of all slaughtered      
things.                                                                     
                                                    {APPENDIX ^paragraph 50}
  "The Urrt Crown hath been given unto him, with gladness of heart, as      
Lord of Hensu."                                                             
-                                                                           
  Who is this?                                                              
-                                                                           
  "He to whom the Urrt Crown hath been given with gladness of heart as      
Lord of Hensu is Osiris. He was bidden to rule among the gods on the        
day of the union of earth [with earth] in the presence of Nebertcher."      
                                                    {APPENDIX ^paragraph 55}
-                                                                           
  Who is this?                                                              
-                                                                           
  "He who was bidden to rule among the gods is the son of Isis              
(Horus), who was appointed to rule in the room of his father Osiris.        
  "As concerning [the words] 'day of the union of earth with earth,'        
they have reference to the union of earth with earth in the coffin          
of Osiris, the Soul that liveth in Hensu, the giver of meat and drink,      
the destroyer of wrong, and the guide to the everlasting paths."            
                                                    {APPENDIX ^paragraph 60}
-                                                                           
  Who is this?                                                              
-                                                                           
  "It is Ra himself."                                                       
-                                                                           
                                                    {APPENDIX ^paragraph 65}
  "[Deliver thou the Osiris the scribe Ani, whose word is truth]            
from the great god who carrrieth away souls, who eateth hearts, who         
feedeth upon offal, who keepeth watch in the darkness, who dwelleth in      
the Seker Boat; those who live in sin fear him."                            
-                                                                           
  Who is this?                                                              
-                                                                           
  "It is Suti, but others say that it is Smamur, the soul of Keb.           
                                                    {APPENDIX ^paragraph 70}
  "Hail, Khepera in thy boat, the two Companies of the Gods are in thy      
body. Deliver thou the Osiris the scribe Ani, whose word is truth,          
from the Watchers who pass sentences of doom, who have been                 
appointed by the god Nebertcher to protect him, and to fasten the           
fetters on his foes, and who slaughter in the torture chambers;             
there is no escape from their fingers. May they never stab me with          
their knives, may I never fall helpless into their chambers of              
torture. I have never done the things which the gods hate. I am he who      
is pure in the Mesqet chamber. And saffron cakes have been brought          
unto him in Tannt."                                                         
-                                                                           
  Who is this?                                                              
-                                                                           
  "It is Khepera in his boat; it is Ra himself.                             
                                                    {APPENDIX ^paragraph 75}
  "As concerning the Watchers who pass sentences of doom, they are the      
Apes Isis and Nephthys.                                                     
  "As concerning the things which the gods hate, they are acts of           
deceit and lying. He who passeth through the place of purification          
within the Mesqet chamber is Anpu (Anubis), who is hard by the              
coffer which containeth the inward parts of Osiris. He to whom saffron      
cakes have been brought in Tannt is Osiris.                                 
  "Others, however, say that the saffron cakes in Tannt represent           
heaven and earth, and others say that they represent Shu, the               
strengthener of the Two Lands in Hensu; and others say that they            
represent the Eye of Horus, and that Tannt is the burial-place of           
Osiris.                                                                     
  "Tem hath builded thy house, and the double Lion-god hath laid the        
foundations of thy habitation. Lo! medicaments have been brought.           
Horus purifieth Set and Set strengtheneth, and Set purifieth and Horus      
strengtheneth.                                                              
  "The Osiris the scribe Ani, whose word is truth before Osiris,            
hath come into this land, and he hath taken possession thereof with         
his two feet. He is Tem, and he is in the city.                             
                                                    {APPENDIX ^paragraph 80}
  "Turn thou back, O Rehu, whose mouth shineth, whose head moveth,          
turn thou back before his strength." Another reading is, 'Turn thou         
back from him who keepeth watch, and is himself unseen.' Let the            
Osiris Ani be safely guarded. He is Isis, and he is found with her          
hair spread over him; it is shaken out over his brow. He was conceived      
by Isis, and engendered by Nephthys, and they have cut away from him        
the things which should be cut from him.                                    
  "Fear followeth after thee, terror is about thine arms. Thou hast         
been embraced for millions of years by arms; mortals go round about         
thee. Thou smitest down the mediators of thy foes, and thou seizest         
the arms of the power of darkness. Thy two sisters (Isis and Nephthys)      
are given to thee for thy delight. Thou hast created that which is          
in Kher-aha, and that which is Anu. Every god feareth thee, for thou        
art exceedingly great and terrible; thou [avengest] every god on the        
man who curseth him, and thou shootest arrows at him. Thou livest           
according to thy will. Thou art Uatchet, the Lady of Flame, evil            
befalleth those who set themselves up against thee."                        
-                                                                           
  What is this?                                                             
-                                                                           
                                                    {APPENDIX ^paragraph 85}
  "'Hidden in form, given of Menhu,' is the name of the "tomb. 'He who      
seeth what is on his hand' is the name of Qerau, or, as others say, it      
is the name of the Block.                                                   
  "Now, he whose mouth shineth and whose head moveth is the phallus of      
Osiris, but others say it is [the phallus] of Ra. 'Thou spreadest           
thy hair, and I shake it out over his brow" is said concerning Isis,        
who hideth in her hair, and draweth it round about her.                     
  "Uatchet, the Lady of Flames, is the Eye of Ra."                          
                                                                            
SEVEN_ARITS                                                                 
  THE SEVEN ARITS                                                           
-                                                                           
-                                                                           
  The First Arit.                                                           
-                                                                           
  The name of the Doorkeeper is Sekhet-her-asht-aru. The name of the        
Watcher is Smetti. The name of the Herald is Hakheru.                       
  The Osiris Ani, whose word is truth, shall say when he cometh unto        
the First Arit: "I am the mighty one who createth his own light. I          
have come unto thee, O Osiris, and, purified from that which                
defileth thee, I adore thee. Lead on. Name not the name of Ra-stau          
to me. Homage to thee, O Osiris, in thy might and in thy strength in        
Ra-stau. Rise up and conquer, O Osiris, in Abtu. Thou goest round           
about heaven, thou sailest in the presence of Ra, thou lookest upon         
all the beings who have knowledge. Hail, Ra, thou who goest round           
about in the sky, I say, O Osiris in truth, that I am the Sahu              
(Spirit-body) of the god, and I beseech thee not to let me be driven        
away, nor to be cast upon the wall of blazing fire. Let the way be          
opened in Ra-stau, let the pain of the Osiris be relieved, embrace          
that which the Balance hath weighed, let a path be made for the Osiris      
in the Great Valley, and let the Osiris have light to guide him on his      
way."                                                                       
-                                                                           
-                                                                           
                                                  {SEVEN_ARITS ^paragraph 5}
  The Second Arit.                                                          
-                                                                           
  The name of the Doorkeeper is Unhat. The name of the Watcher is           
Seqt-her. The name of the Herald is Ust.                                    
  The Osiris Ani, whose word is truth, shall say [when he cometh to         
this Arit]: "He sitteth to carry out his heart's desire, and he             
weigheth words as the Second of Thoth. The strength which protecteth        
Thoth humbleth the hidden Maati gods, who feed upon Maat during the         
years of their lives. I offer up my offerings [to him] at the moment        
when he maketh his way. I advance, and I enter on the path. O grant         
thou that I may continue to advance, and that I may attain to the           
sight of Ra, and of those who offer up [their] offerings."                  
-                                                                           
-                                                                           
                                                 {SEVEN_ARITS ^paragraph 10}
  The Third Arit.                                                           
-                                                                           
  The name of the Doorkeeper is Unem-hauatu-ent-pehui. The name of the      
Watcher is Seres-her. The name of the Herald is Aa.                         
  The Osiris the scribe Ani, whose word is truth, shall say [when he        
cometh to this Arit]: "I am he who is hidden in the great deep. I am        
the Judge of the Rehui, I have come and I have done away the offensive      
thing which was upon Osiris. I tie firmly the place on which he             
standeth, coming forth from the Urt. I have stablished things in Abtu,      
I have opened up a way through Ra-stau, and I have relieved the pain        
which was in Osiris. I have balanced the place whereon he standeth,         
and I have made a path for him; he shineth brilliantly in Ra-stau."         
-                                                                           
-                                                                           
                                                 {SEVEN_ARITS ^paragraph 15}
  The Fourth Arit.                                                          
-                                                                           
  The name of the Doorkeeper is Khesef-her-asht-kheru. The name of the      
Watcher is Seres-tepu. The name of the Herald is Khesef-at.                 
  The Osiris the scribe Ani, whose word is truth, shall say [when he        
cometh to this Arit]: "I am the Bull, the son of the ancestress of          
Osiris. O grant ye that his father, the Lord of his god-like                
companions, may bear witness on his behalf. I have weighed the              
guilty in judgment. I have brought unto his nostrils the life which is      
ever lasting. I am the son of Osiris, I have accomplished the journey,      
I have advanced in Khert-Neter."                                            
-                                                                           
-                                                                           
                                                 {SEVEN_ARITS ^paragraph 20}
  The Fifth Arit.                                                           
-                                                                           
  The name of the Doorkeeper is Ankhf-em-fent. The name of the Watcher      
is Shabu. The name of the Herald is Teb-her-kha-kheft.                      
  The Osiris the scribe Ani, whose word is truth, shall say [when he        
cometh to this Arit]: "I have brought unto thee the jawbone in              
Ra-stau. I have brought unto thee thy backbone in Anu. I have gathered      
together his manifold members therein. I have driven back Aapep for         
thee. I have spit upon the wounds [in his body]. I have made myself         
a path among you. I am the Aged One among the gods. I have made             
offerings to Osiris. I have defended him with the word of truth. I          
have gathered together his bones, and have collected all his members."      
-                                                                           
-                                                                           
                                                 {SEVEN_ARITS ^paragraph 25}
  The Sixth Arit.                                                           
-                                                                           
  The name of the Doorkeeper is Atek-tau-kehaq-kheru. The name of           
the Watcher is An-her. The name of the Herald is Ates-her-[ari]-she.        
  The Osiris the scribe Ani, whose word is truth, shall say [when he        
cometh to this Arit]: "I have come daily, I have come daily. I have         
made myself a way. I have advanced over that which was created by Anpu      
(Anubis). I am the Lord of the Urrt Crown. I am the possessor [of           
the knowledge of] the words of magical power, I am the Avenger              
according to law, I have avenged [the injury to] his Eye. I have            
defended Osiris. I have accomplished my journey. The Osiris Ani             
advanceth with you with the word which is truth."                           
-                                                                           
-                                                                           
                                                 {SEVEN_ARITS ^paragraph 30}
  The Seventh Arit:                                                         
-                                                                           
  The name of the Doorkeeper is Sekhmet-em-tsu-sen. The name of the         
Watcher is Aa-maa-kheru. The name of the Herald is Khesef-khemi.            
  The Osiris the scribe Ani, whose word is truth, shall say [when he        
cometh to this Arit]: "I have come unto thee, O Osiris, being purified      
from foul emissions. Thou goest round about heaven, thou seest Ra,          
thou seest the beings who have knowledge. [Hail], thou, ONE! Behold,        
thou art in the Sektet Boat which traverseth the heavens. I speak what      
I will to his Sahu (Spirit-body). He is strong, and cometh into             
being even [as] he spake. Thou meetest him face to face. Prepare            
thou for me all the ways which are good [and which lead] to thee."          
-                                                                           
                                                 {SEVEN_ARITS ^paragraph 35}
  RUBRIC: If [these] words be recited by the spirit when he shall come      
to the Seven Arits, and as he entereth the doors, he shall neither          
be turned back nor repulsed before Osiris, and he shall be made to          
have his being among the blessed spirits, and to have dominion among        
the ancestral followers of Osiris. If these things be done for any          
spirit he shall have his being in that place like a lord of eternity        
in one body with Osiris, and at no place shall any being contend            
against him.                                                                
                                                                            
PYLONS_OF_THE_HOUSE_OF_OSIRIS                                               
  THE PYLONS OF THE HOUSE OF OSIRIS                                         
-                                                                           
  The following shall be said when one cometh to the FIRST PYLON.           
The Osiris the scribe Ani, whose word is truth, saith: "Lady of             
tremblings, high-walled, the sovereign lady, the lady of                    
destruction, who uttereth the words which drive back the destroyers,        
who delivereth from destruction him that cometh." The name of her           
Doorkeeper is Neruit.                                                       
-                                                                           
  The following shall be said when one cometh to the SECOND PYLON. The      
Osiris the scribe Ani, whose word is truth, saith: "Lady of heaven,         
Mistress of the Two Lands, devourer by fire, Lady of mortals, who           
art infinitely greater than any human being." The name of her               
Doorkeeper is Mes-Ptah.                                                     
-                                                                           
  The following shall be said when one cometh to the THIRD PYLON.           
The Osiris the scribe Ani, whose word is truth, saith: "Lady of the         
Altar, the mighty lady to whom offerings are made, greatly beloved one      
of every god sailing up the river to Abydos." The name of her               
Doorkeeper is Sebqa.                                                        
                                {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 5}
-                                                                           
  The following shall be said when one cometh to the FOURTH PYLON. The      
Osiris the scribe Ani, whose word is truth, saith: "Prevailer with          
knives, Mistress of the Two Lands, destroyer of the enemies of the          
Still-Heart (Osiris), who decreeth the release of those who suffer          
through evil hap." The name of her Doorkeeper is Nekau.                     
-                                                                           
  The following shall be said when one cometh to the FIFTH PYLON.           
The Osiris the scribe Ani, whose word is truth, saith: "Flame, Lady of      
fire, absorbing the entreaties which are made to her, who permitteth        
not to approach her the rebel." The name of her Doorkeeper is               
Henti-Reqiu.                                                                
-                                                                           
                               {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 10}
  The following shall be said when one cometh to the SIXTH PYLON.           
The Osiris the scribe Ani, whose word is truth, saith: "Lady of light,      
who roareth mightily, whose breadth cannot be comprehended. Her like        
hath not been found since the beginning. There are serpents over which      
are unknown. They were brought forth before the Still-Heart." The name      
of her Doorkeeper is Semati.                                                
-                                                                           
  The following shall be said when one cometh to the SEVENTH PYLON.         
The Osiris the scribe Ani, whose word is truth, saith: "Garment             
which envelopeth the helpless one, which weepeth for and loveth that        
which it covereth." The name of her Doorkeeper is Saktif.                   
-                                                                           
  The following shall be said when one cometh to the EIGHTH PYLON. The      
Osiris the scribe Ani, whose word is truth, saith: "Blazing fire,           
unquenchable, with far-reaching tongues of flame, irresistible              
slaughterer, which one may not pass through fear of its deadly              
attack." The name of her Doorkeeper is Khutchetef.                          
                               {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 15}
-                                                                           
  The following shall be said when one cometh to the NINTH PYLON.           
The Osiris the scribe Ani, whose word is truth, saith:                      
"Chieftainess, lady of strength, who giveth quiet of heart to the           
offspring of her lord. Her girth is three hundred and fifty khet,           
and she is clothed with green feldspar of the South. She bindeth up         
the divine form and clotheth the helpless one. Devourer, lady of all        
men." The name of her Doorkeeper is Arisutchesef.                           
-                                                                           
  The following shall be said when one cometh to the TENTH PYLON.           
The Osiris the scribe Ani, whose word is truth, saith: "Goddess of the      
loud voice, who maketh her suppliants to mourn, the awful one who           
terrifieth, who herself remaineth unterrified within." The name of her      
Doorkeeper is Sekhenur.                                                     
-                                                                           
                               {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 20}
  Nu, the steward of the keeper of the seal, saith when he cometh to        
the ELEVENTH PYLON of Osiris: "I have made my way, I know you, and I        
know thy name, and I know the name of her who is within thee: She           
who slayeth always, consumer of the fiends by fire, mistress of             
every pylon, the lady who is acclaimed on the day of darkness" is           
thy name. She inspecteth the swathing of the helpless one.                  
-                                                                           
  The Osiris Nu, the steward of the keeper of the seal, saith when          
he cometh to the TWELFTH PYLON of Osiris: "I have made my way, I            
know you, and I know thy name, and I know the name of her who is            
within thee: Invoker of thy Two Lands, destroyer of those who come          
to thee by fire, lady of spirits, obeyer of the word of thy Lord" is        
thy name. She inspecteth the swathing of the helpless one.                  
-                                                                           
  The Osiris Nu, the steward of the keeper of the seal, saith when          
he cometh to the THIRTEENTH PYLON of Osiris: "I have made my way, I         
know you and I know thy name, and I know the name of her who is within      
thee: Osiris foldeth his arms about her, and maketh Hapi (the               
Nile-god), to emit splendour out of his hidden places" is thy name.         
She inspecteth the swathing of the helpless one.                            
                               {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 25}
-                                                                           
  The Osiris Nu, the steward of the keeper of the seal, saith when          
he cometh to the FOURTEENTH PYLON of Osiris: "I have made my way, I         
know thee, and I know thy name, and I know the name of her who is           
within thee. Lady of might, who trampleth on the Red Demons, who            
keepeth the festival of Haaker on the day of the hearing of faults" is      
thy name. She inspecteth the swathing of the helpless one.                  
-                                                                           
  THE FIFTEENTH PYLON. The Osiris Heru-em-khebit, whose word is truth,      
shall say when he cometh to this pylon: "Fiend, red of hair and             
eyes, who appeareth by night, and doth fetter the fiend in his lair.        
Let her hands be given to the Still-Heart in his hour, let her advance      
and go forward" is thy name. She inspecteth the swathing of the             
helpless one.                                                               
-                                                                           
                               {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 30}
  THE SIXTEENTH PYLON. The Osiris Heru-em-khebit, whose word is truth,      
shall say when he cometh to this pylon: "Terrible one, lady of the          
rain-storm, destroyer of the souls of men, devourer of the bodies of        
men, orderer, producer, and maker of slaughter" is thy name. She            
inspecteth the swathing of the helpless one.                                
-                                                                           
  THE SEVENTEENTH PYLON. The Osiris Heru-em-khebit, whose word is           
truth, shall say when he cometh to this pylon: "Hewer-in-pieces in          
blood, Ahibit, lady of hair" is thy name. She inspecteth the                
swathing of the helpless one.                                               
-                                                                           
  THE EIGHTEENTH PYLON. The Osiris Heru-em-khebit, whose word is            
truth, shall say when he cometh to this pylon: "Fire-lover, pure            
one, lover of slaughterings, cutter off of heads, devoted one, lady of      
the Great House, slaughterer of fiends at eventide" is thy name. She        
inspecteth the swathing of the helpless one.                                
                               {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 35}
-                                                                           
  THE NINETEENTH PYLON. The Osiris Heru-em-khebit, whose word is            
truth, shall say when he cometh to this pylon: "Light-giver for             
life, blazing all the day, lady of strength [and of] the writings of        
the god Thoth himself" is thy name. She inspecteth the swathings of         
the White House.                                                            
-                                                                           
  THE TWENTIETH PYLON. The Osiris Heru-em-khebit, whose word is truth,      
shall say when he cometh to this pylon: "Dweller in the cavern of           
her lord, her name is Clother, hider of her creations, conqueror of         
hearts, swallower [of them]" is thy name. She inspecteth the swathings      
of the White House.                                                         
-                                                                           
                               {PYLONS_OF_THE_HOUSE_OF_OSIRIS ^paragraph 40}
  THE TWENTY-FIRST PYLON. The Osiris Heru-em-khebit, whose word is          
truth, shall say when he cometh to this pylon: "Knife which cutteth         
when [its name] is uttered, slayer of those who approach thy flame" is      
thy name. She possesseth hidden plans.                                      
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Turin Papryus, ed. Lepsius, Bl. 64, the text referring          
to the twenty-first Pylon.)                                                 
-                                                                           
  THE OSIRIS AUFANKH, WHOSE WORD IS TRUTH, SAITH: Hail, saith Horus, O      
Twenty-first pylon of the Still-Heart! I have made the way. I know          
thee. I know thy name. I know the name of the goddess who guardeth          
thee. "Sword that smiteth at the utterance of its own name, stinking        
face, overthrower of him that approacheth her flame" is thy name. Thou      
keepest the hidden things of the avenger of the god, thou guardest          
them. Amam is his name. He maketh the ash trees (cedars) not to             
grow, and the shenu trees (acacias) not to blossom, and preventeth          
copper from being found in the mountain. The Tchatcha (Chiefs) of this      
Pylon are Seven Gods. Tchen, or Anthch (At), is the name of the one at      
the door. Hetepmes is the name of another there. Messep is the name of      
another there. Utchara is the name of another there. Beq is the name        
of another there. Anp (Anubis) is the name of another there.                
  I have made the way. I am Menu-Heru, the avenger of his father,           
the heir of his father Un-Nefer. I have come. I have given [offerings]      
to my father Osiris. I have overthrown all his enemies. I have come         
daily with the word of truth, the lord of fealty, in the house of my        
father Tem, the Lord of Anu, I, the Osiris Auf-ankh, whose word is          
truth in the southern heaven. I have done what is right for him that        
made the right, I have celebrated the Haker festival to the lord            
thereof. I have acted as the leader of the festivals. I have given          
cakes to the Lords of the Altar. I have been the leader of the              
propitiatory offerings, cakes, ale, oxen, geese, to my father Osiris        
Un-Nefer. I am the protector of the Ba-soul, I have made the Benu bird      
to appear [by my] words. I have come daily into the house of the god        
to make offerings of incense. I have come with the shenti tunic. I          
have set the Neshem Boat afloat on the water. I have made the word          
of Osiris Khenti Amenti to be truth before his enemies. I have carried      
away in a boat all his enemies to the slaughter-house of the East, and      
they shall never escape from the wardship of the god Keb who                
dwelleth therein. I have made the Kefaiu gods of Ra to stand up, I          
have made his word to be truth. I have come as a scribe. I have             
explained [the writings]. I have made the god to have power over his        
legs. I have come into the house of him that is upon his mountain           
(Anubis). I have seen the Chief of the Seh hall. I have entered into        
Ra-stau. I have made myself invisible. I have found for myself the          
boundary. I have approached Nerutef. I have clothed the naked. I            
have sailed up the river to Abydos. I have performed the ceremonies of      
Hu and Sa. I have entered the house of Astes. I have made supplication      
to the Khati gods and to Sekhmet in the temple of Net (Neith), or           
the Aged Ones. I have entered Ra-stau. I have made myself invisible. I      
have found the frontier. I have approached Nerutef. I have clothed the      
naked. I have sailed up the river to Abydos. I have performed the           
ceremonies of Hu and Sa. I have received. I have risen like a king          
crowned. I fill my seat on the throne in the place of my father, the        
God Who was at the beginning. I have praised the Meskhen of                 
Ta-tchesert. My mouth is full of Maat (Truth). I have overwhelmed           
the Akhekhau serpents. I have come into the Great House with [my] body      
in a flourishing condition. I have caused myself to travel in the Boat      
of Hai. The myrrh unguent of..... is in the hair of men (Rekhit). I         
have entered into the House of Astes. I have approached with worship        
the two Khati gods and Sekhmet, who are in the temple of the Aged           
One [in Anu].                                                               
  [And the god Osiris saith:] "Thou hast come, thou shalt be a              
favoured one in Tetu, O Osiris Auf-ankh, whose word is truth, the           
son of the lady Shert-en-Menu, whose word is truth."                        
                                                                            
PRIESTS_ANMUTEF_AND_SAMEREF                                                 
  THE PRIESTS ANMUTEF AND SAMEREF                                           
-                                                                           
  THE SPEECH OF THE PRIEST ANMUTEF.                                         
  I have come unto you, O ye great Tchatcha Chiefs who dwell in             
heaven, and upon earth, and in Khert-Neter, and I have brought unto         
you the Osiris Ani. He hath not committed any act which is an               
abomination before all the gods. Grant ye that he may live with you         
every day.                                                                  
  The Osiris the scribe Ani adoreth Osiris, Lord of Rasta, and the          
Great Company of the Gods who live in Khert-Neter. He saith: "Homage        
to thee, Khenti Amenti, Un-Nefer, who dwellest in Abtu. I come to           
thee. My heart holdeth Truth. There is no sin in my body. I have not        
told a lie wittingly, I have not acted in a double manner. Grant            
thou to me cakes, let me appear in the presence, at the altar of the        
Lords of Truth, let me go in and come forth from Khert-Neter [at            
will], let not my Heart-soul be driven away [from me]; and grant me         
a sight of the Disk and the beholding of the Moon for ever and ever.        
-                                                                           
-                                                                           
  THE SPEECH OF THE PRIEST SAMEREF.                                         
                                  {PRIESTS_ANMUTEF_AND_SAMEREF ^paragraph 5}
  I have come unto you, O ye Tchatcha Chiefs who dwell in Rasta, and I      
have brought unto you the Osiris Ani, grant ye unto him cakes, and          
water, and air, and a homestead in Sekhet-hetep as to the followers of      
Horus.                                                                      
  The Osiris the scribe Ani, whose word is truth, adoreth Osiris,           
the Lord of everlastingness, and the Tchatcha Chiefs, the Lords of          
Rasta. He saith: "Homage to thee, O King of Khert-Neter, thou Governor      
of Akert! I have come unto thee. I know thy plans, I am equipped            
with the forms which thou takest in the Tuat. Give thou to me a             
place in Khert-Neter, near the Lords of Truth. May my homestead be          
lasting in Sekhet-hetep, may I receive cakes in thy presence."              
                                                                            
JUDGES_IN_ANU                                                               
  THE JUDGES IN ANU                                                         
-                                                                           
  Hail, Thoth, who madest to be true the word of Osiris against his         
enemies, make thou the word of the scribe Nebseni to be true against        
his enemies, even as thou didst make the word of Osiris to be true          
against his enemies, in the presence of the Tchatcha Chiefs who are         
with Ra and Osiris in Anu, on the night of the "things of the               
night," and the night of battle, and of the fettering of the Sebau          
fiends, and the day of the destruction of the enemies of Neb-er-tcher.      
-                                                                           
  Now the great Tchatcha Chiefs in Anu are Tem, Shu, Tefnut, [Osiris        
and Thoth]. Now the "fettering of the Sebau fiends" signifieth the          
destruction of the Smaiu fiends of Set, when he wrought iniquity a          
second time.                                                                
  Hail, Thoth, who didst make the word of Osiris to be true against         
his enemies, make thou the word of the Osiris Ani to be true against        
his enemies, with the great Tchatcha Chiefs who are in Tetu, on the         
night of setting up the Tet in Tetu.                                        
-                                                                           
                                                {JUDGES_IN_ANU ^paragraph 5}
  Now the great Tchatcha Chiefs who are in Tetu are Osiris, Isis,           
Nephthys, and Horus the avenger of his father. Now the "setting up          
of the Tet in Tetu" signifieth [the raising up of] the shoulder of          
Horus, the Governor of Sekhem. They are round about Osiris in the band      
[and] the bandages.                                                         
  Hail, Thoth, who didst make the word of Osiris to be true against         
his enemies, make thou the word of the Osiris Ani to be true against        
his enemies, with the great Tchatcha Chiefs who are in Sekhem, on           
the night of the "things of the night" in Sekhem.                           
-                                                                           
  Now the great Tchatcha Chiefs who are in Sekhem are                       
Heru-khenti-en-ariti and Thoth who is with the Tchatcha Chiefs of           
Nerutef. Now the night of the "things of the night festival"                
signifieth the dawn on the sarcophagus of Osiris.                           
  Hail, Thoth, who didst make the word of Osiris to be true against         
his enemies, make thou the word of the Osiris the scribe Ani to be          
true against his enemies, with the great Tchatcha Chiefs who are in         
the double town Pe-Tep, on the night of setting up the "Senti" of           
Horus, and of establishing him in the inheritance of the possessions        
of his father Osiris.                                                       
                                               {JUDGES_IN_ANU ^paragraph 10}
-                                                                           
  Now the great Tchatcha Chiefs who are in Pe-Tep are Horus, Isis,          
Kesta (Mesta) and Hapi. Now the "setting up of the 'Senti' of Horus"        
hath reference to the words which Set spake to his followers, saying        
"Set up the Senti."                                                         
  Hail, Thoth, who didst make the word of Osiris to be true against         
his enemies, make thou the word of the Osiris the scribe Ani to be          
true, in peace, against his enemies, with the great Tchatcha Chiefs         
who are in the Lands of the Rekhti (Taiu-Rekhti), in the night when         
Isis lay down, and kept watch to make lamentation for her brother           
Osiris.                                                                     
-                                                                           
  Now the great Tchatcha Chiefs who are in Taiu-Rekhti are Isis,            
Horus, Kesta (Mesta) [Anpu and Thoth].                                      
                                               {JUDGES_IN_ANU ^paragraph 15}
  Hail, Thoth, who didst make the word of Osiris true against his           
enemies, make thou the word of Osiris the scribe Ani, whose word is         
truth, in peace, to be true against his enemies, with the great             
Tchatcha Chiefs who are in Abtu, on the night of the god Haker, when        
the dead are separated, and the spirits are judged, and when the            
procession taketh place in Teni.                                            
-                                                                           
  Now the great Tchatcha Chiefs who are in Abtu are Osiris, Isis,           
and Up-uat.                                                                 
  Hail, Thoth, who didst make the word of Osiris to be true against         
his enemies, make thou the word of the Osiris, the scribe and assessor      
of the sacred offerings which are made to all the gods, Ani, to be          
true against his enemies, with the Tchatcha Chiefs who examine the          
dead on the night of making the inspection of those who are to be           
annihilated.                                                                
-                                                                           
                                               {JUDGES_IN_ANU ^paragraph 20}
  Now the great Tchatcha Chiefs who are present at the examination          
of the dead are Thoth, Osiris, Anpu and Asten (read Astes). Now the         
inspection (or, counting) of those who are to be annihilated                
signifieth the shutting up of things from the souls of the sons of          
revolt.                                                                     
  Hail, Thoth, who didst make the word of Osiris true against his           
enemies, make thou the word of the Osiris the scribe Ani to be true         
against his enemies, with the great Tchatcha Chiefs who are present at      
the digging up of the earth [and mixing it] with their blood, and of        
making the word of Osiris to be true against his enemies.                   
-                                                                           
  As concerning the Tchatcha Chiefs who are present at the digging          
up of the earth in Tetu: When the Smaiu fiends of Set came [there],         
having transformed themselves into animals, these Tchatcha Chiefs slew      
them in the presence of the gods who were there, and they took their        
blood, and carried it to them. These things were permitted at the           
examination [of the wicked] by those [gods] who dwelt in Tetu.              
  Hail, Thoth, who didst make the word of Osiris to be true against         
his enemies, make thou the word of the Osiris [the scribe] Ani to be        
true against his enemies, with the great Tchatcha Chiefs who are in         
Nerutef on the night of the "Hidden of Forms."                              
                                               {JUDGES_IN_ANU ^paragraph 25}
-                                                                           
  Now the great Tchatcha Chiefs who are in Nerutef are Ra, Osiris, Shu      
and Bebi.                                                                   
  Now, the night of the "Hidden of Forms" referreth to the placing          
on the sarcophagus [of Osiris] the arm, the heel, and the thigh of          
Osiris Un-Nefer.                                                            
  Hail, Thoth, who didst make the word of Osiris true against his           
enemies, make thou the word of the Osiris, whose word is truth, to          
be true against his enemies, with the great Tchatcha Chiefs who are in      
Rasta, on the night when Anpu lay with his arms on the things by            
Osiris, and when the word of Horus was make to be true against his          
enemies.                                                                    
-                                                                           
                                               {JUDGES_IN_ANU ^paragraph 30}
  The great Tchatcha Chiefs who are in Rasta are Horus, Osiris, and         
Isis. The heart of Osiris is happy, the heart of Horus is glad, and         
the two halves of Egypt (Aterti) are well satisfied thereat.                
  Hail, Thoth, who didst make the word of Osiris true against his           
enemies, make thou the word of the Osiris the scribe Ani, the assessor      
of the holy offerings made to all the gods, to be true against his          
enemies, with the Ten great Tchatcha Chiefs who are with Ra, and            
with Osiris, and with every god, and with every goddess, in the             
presence of the god Nebertcher. He hath destroyed his enemies, and          
he hath destroyed every evil thing which appertained to him.                
-                                                                           
  RUBRIC: If this Chapter be recited for, or over, the deceased, he         
shall come forth by day, purified after death, according to the desire      
of his heart. Now if this Chapter be recited over him, he shall             
progress over the earth, and he shall escape from every fire, and none      
of the evil things which appertain to him shall ever be round about         
him; never, a million times over, shall this be.                            
                                                                            
OPENING_THE_MOUTH                                                           
-                                                                           
  THE CHAPTER OF OPENING THE MOUTH OF THE OSIRIS ANI. To be said:- The      
god Ptah shall open my mouth, and the god of my town shall unfasten         
the swathings, the swathings which are over my mouth. Thereupon             
shall come Thoth, who is equipped with words of power in great              
abundance, and shall untie the fetters, even the fetters of the god         
Set which are over my mouth. And the god Tem shall cast them back at        
those who would fetter me with them, and cast them at him. Then             
shall the god Shu open my mouth, and make an opening into my mouth          
with the same iron implement wherewith he opened the mouth of the           
gods. I am the goddess Sekhmet, and I take my seat upon the place by        
the side of Amt-ur the great wind of heaven. I am the great                 
Star-goddess Saah, who dwelleth among the Souls of Anu. Now as              
concerning every spell, and every word which shall be spoken against        
me, every god of the Divine Company shall set himself in opposition         
thereto.                                                                    
                                                                            
BRINGING_SPELLS_TO_ANI                                                      
-                                                                           
  THE CHAPTER OF BRINGING WORDS OF POWER TO THE OSIRIS ANI, who             
saith:- I am Tem-Khepera who produced himself on the thighs of his          
divine mother. Those who dwell in Nu have been made wolves, and those       
who are among the Tchatcha Chiefs have become hyenas. Behold, I will        
gather together to myself this charm from the person with whom it is        
[and from the place] wherein it is [and it shall come to me] quicker        
than a greyhound, and swifter that light. Hail, thou who bringest the       
Ferry-Boat of Ra, thou holdest thy course firmly and directly in the        
north wind as thou sailest up the river towards the Island of Fire          
which is in Khert-Neter. Behold, thou shalt gather together to thee         
this charm from wheresoever it may be, and from whomsoever it may be        
with [and it shall come to me] quicker than a greyhound, and swifter        
than light. It (the charm) made the transformations of Mut; it              
fashioned the gods [or] kept them silent; by it Mut gave the warmth         
[of life] to the gods. Behold, these words of power are mine, and           
they shall come unto me from wheresoever they may be, or with               
whomsoever they may be, quicker than greyhounds and swifter than            
light, or, according to another reading, "swifter than shadows."            
                                                                            
BRINGING_SPELLS_TO_ANI|APPENDIX                                             
  APPENDIX                                                                  
-                                                                           
  THE CHAPTER WHICH MAKETH A MAN TO REMEMBER HIS NAME IN                    
KHERT-NETER. [The deceased] saith:- Let my name be given to me in           
the Great House (Per-ur), and let me remember my name in the House          
of Fire (Per Neser), on the night wherein the years are counted up,         
and the number of the months is told. I am dwelling with the Divine         
One, I take my seat on the eastern side of the sky. If any god              
cometh after me, I shall be able to declare his name forthwith.             
                                                                            
GIVING_A_HEART                                                              
-                                                                           
  THE CHAPTER OF GIVING A HEART TO THE OSIRIS ANI IN KHERT-NETER. He        
saith:- Let my heart be with me in the House of Hearts. Let my              
heart-case be with me in the House of heart-cases. Let my heart be          
with me, and let it rest in [me or] I shall not eat the cakes of            
Osiris in the eastern side of the Lake of Flowers, nor have a boat          
wherein to float down the river, nor a boat to sail up the river to         
thee, nor be able to embark in a boat with thee. Let my mouth be to me      
that I may speak therewith. Let my legs be to me that I may walk            
therewith. Let my arms be to me that I may overthrow the foe                
therewith. Let the two doors of the sky be opened to me. May Keb,           
the Erpat of the gods, open his jaws to me. May he open my two eyes         
which are blinded by swathings. May he make me to lift up my legs in        
walking which are tied together. May Anpu make my thighs to become          
vigorous. May the goddess Sekhmet raise me, and lift me up. Let me          
ascend into heaven, let that which I command be performed in                
Het-ka-Ptah. I know how to use my heart. I am master of my heart-case.      
I am master of my hands and arms. I am master of my legs. I have the        
power to do that which my KA desireth to do. My Heart-soul shall not        
be kept a prisoner in my body at the gates of Amentet when I would          
go in in peace and come forth in peace.                                     
                                                                            
NOT_LETTING_THE_HEART_ANI_BE_TAKEN                                          
-                                                                           
  THE CHAPTER OF NOT LETTING THE HEART OF THE OSIRIS, THE ASSESSOR          
OF THE DIVINE OFFERINGS OF ALL THE GODS, ANI, WHOSE WORD IS TRUTH           
BEFORE OSIRIS, BE DRIVEN BACK FROM HIM IN KHERT-NETER. He saith:- My        
heart of my mother. My heart of my mother. My heart-case of my              
transformations. Let not any one stand up to bear testimony against         
me. Let no one drive me away from the Tchatcha Chiefs. Let no one make      
thee to fall away from me in the presence of the Keeper of the              
Balance. Thou art my KA, the dweller in my body, the god Khnemu who         
makest sound my members. Mayest thou appear in the place of                 
happiness whither we go. Let not make my name to stink Shenit               
Chiefs, who make men to be stable. [Let it be satisfactory unto us,         
and let the listening be satisfactory unto us, and let there be joy of      
heart to us at the weighing of words. Let not lies be told against          
me before the Great God, the Lord of Amentet. Verily, how great             
shalt thou be when thou risest up in triumph!]                              
-                                                                           
  RUBRIC I: These words are to be said over a scarab of green stone         
encircled with a band of refined copper, and [having] a ring of             
silver; which shall be placed on the neck of the Khu (the deceased),        
etc.                                                                        
  RUBRIC II (From the Papyrus of Nu, Sheet 21): If this Chapter be          
known [by the deceased] he shall be declared a speaker of the truth         
both upon earth and in Khert-Neter, and he shall be able to perform         
every act which a living human being can perform. Now it is a great         
protection which hath been given by the god. This Chapter was found in      
the city of Khemenu upon the slab of ba, which was inlaid with              
[letters of] genuine lapis-lazuli, and was under the feet of [the           
statue] of the god, during the reign of His Majesty, the King of the        
South and North, Menkaura (Mycerinus), true of word, by Prince              
Herutataf, who found it during a journey which he made to inspect           
the temples. One Nekht was with him who was diligent in making him          
to understand it, and he brought it to the king as a wonderful              
object when he perceived that it was a thing of great mystery, [the         
like of] which had never [before] been seen or looked upon. This            
Chapter shall be recited by a man who is ceremonially clean and             
pure, who hath not eaten the flesh of animals, or fish, and who hath        
not had intercourse with women. And behold, thou shalt make a scarab        
of green stone, with a rim [plated] with gold, which shall be placed        
above the heart of a man, and it shall perform for him the "opening of      
the mouth." And thou shalt anoint it with myrrh unguent, and thou           
shalt recite over it the following words of magical power. [Here            
follows the text of the Chapter of Not Letting the Heart of Ani Be          
Taken from Him.]                                                            
                                                                            
NOT_LETTING_THE_HEART_SOUL_BE_CARRIED_AWAY                                  
-                                                                           
  THE CHAPTER OF NOT LETTING THE HEART-SOUL OF A MAN BE SNATCHED            
AWAY FROM HIM IN KHERT-NETER. The Osiris the scribe Ani saith:--I,          
even I, am he who cometh forth from the Celestial Water (Akeb). He          
(Akeb) produced abundance for me, and hath the mastery there in the         
form of the River.                                                          
-                                                                           
  (This is a portion of a longer Chapter which is included in the           
appendix.)                                                                  
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (The following is from the Papyrus of Nefer-uben-f, Naville, op.          
cit., I, Bl. 72.)                                                           
-                                                                           
  THE CHAPTER OF DRINKING WATER IN KHERT-NETER. The am khent priest,        
Nefer-uben-f, whose word is truth, saith:- I, even I, am he who cometh      
forth from the god Keb. The water-flood is given to him, he hath            
become the master thereof in the form of Hapi. I, the am khent              
Nefer-uben-f, open the doors of heaven. Thoth hath opened to me the         
doors of Qebh (the Celestial Waters). Lo, Hepi Hepi, the two sons of        
the Sky, mighty in splendour, grant ye that I may be master over the        
water, even as Set had dominion over his evil power on the day of           
the storming of the Two Lands. I pass by the Great Ones, arm to             
shoulder, even as they pass that Great God, the Spirit who is               
equipped, whose name is unknown. I have passed by the Aged One of           
the shoulder. I am Nefer-uben-f, whose word is truth. Hath opened to        
me the Celestial Water Osiris. Hath opened to me the Celestial Water        
Thoth-Hapi, the Lord of the horizon, in his name of "Thoth, cleaver of      
the earth." I am master of the water, as Set is master of his               
weapon. I sail over the sky, I am Ra, I am Ru. I am Sma. I have             
eaten the Thigh, I have seized the bone and flesh. I go round about         
the Lake of Sekhet-Ar. Hath been given to me eternity without limit.        
Behold, I am the heir of eternity, to whom hath been given                  
everlastingness.                                                            
-                                                                           
-                                                                           
  (The following two Chapters are from the Papyrus of Nu, Sheets 7 and      
12)                                                                         
-                                                                           
                                                     {APPENDIX ^paragraph 5}
  THE CHAPTER OF DRINKING WATER AND OF NOT BEING BURNT UP BY FIRE           
[IN KHERT-NETER]. Nu saith:- Hail, Bull of Amentet! I am brought            
unto thee. I am the paddle of Ra wherewith he transported the Aged          
Gods. Let me neither be burnt up nor destroyed by fire. I am Beb,           
the firstborn son of Osiris, to whom every god maketh an offering in        
the temple of his Eye in Anu. I am the divine Heir, the Mighty One,         
the Great One, the Resting One. I have made my name to flourish.            
Deliverer, thou livest in me [every day].                                   
-                                                                           
  THE CHAPTER OF NOT BEING BOILED IN FIRE. Nu saith:- I am the              
paddle which is equipped, wherewith Ra transported the Aged Gods,           
which raised up the emissions of Osiris from the Lake of blazing fire,      
and he was not burned. I sit down like the Light-god, and like Khnemu,      
the Governor of lions. Come, cut away the fetters from him that             
passeth by the side of this path, and let me come forth therefrom.          
                                                                            
GIVING_AIR                                                                  
-                                                                           
  THE CHAPTER OF GIVING AIR IN KHERT-NETER. The Osiris Ani saith:- I        
am the Egg which dwelt in the Great Cackler. I keep ward over that          
great place which Keb hath proclaimed upon earth. I live; it liveth. I      
grow up, I live, I snuff the air. I am Utcha-aab. I go round about his      
egg [to protect it]. I have thwarted the moment of Set. Hail, Sweet         
one of the Two Lands! Hail, dweller in the tchefa food! Hail,               
dweller in the lapis-lazuli! Watch ye over him that is in his               
cradle, the Babe when he cometh forth to you.                               
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu, Sheet 12)                                        
-                                                                           
  THE CHAPTER OF GIVING AIR TO NU IN KHERT-NETER. He saith:- Hail,          
thou God Temu, grant thou unto me the sweet breath which dwelleth in        
thy nostrils! I am the Egg which is in Kenken-ur (the Great                 
Cackler), and I watch and guard that mighty thing which hath come into      
being, wherewith the god Keb hath opened the earth. I live; it liveth;      
I grow, I live, I snuff the air. I am the god Utcha-aabet, and I go         
about his egg. I shine at the moment of the mighty of strength,             
Suti. Hail, thou who makest sweet the time of the Two Lands! Hail,          
dweller among the celestial food. Hail, dweller among the beings of         
blue (lapis-lazuli), watch ye to protect him that is in his nest,           
the Child who cometh forth to you.                                          
-                                                                           
-                                                                           
  THE CHAPTER OF GIVING AIR IN KHERT-NETER. Nu saith:- I am the jackal      
of jackals. I am Shu. I draw air from the presence of the Light-god,        
from the uttermost limits of heaven, from the uttermost limits of           
earth, from the uttermost limits of the pinion of Nebeh bird. May           
air be given unto this young divine Babe. [My mouth is open, I see          
with my eyes.]                                                              
-                                                                           
-                                                                           
                                                     {APPENDIX ^paragraph 5}
  THE CHAPTER OF SNUFFING THE AIR WITH WATER IN KHERT-NETER. Hail,          
Tem. Grant thou unto me the sweet breath which dwelleth in thy              
nostrils. I am he who embraceth that great throne which is in the city      
of Unu. I keep watch over the Egg of Kenken-ur (the Great Cackler).         
I grow and flourish as it groweth and flourisheth. I live as it             
liveth. I snuff the air as it snuffeth the air.                             
                                                                            
NOT_LETTING_THE_HEART_BE_SNATCHED_AWAY                                      
-                                                                           
  THE CHAPTER OF NOT LETTING THE HEART OF A MAN BE SNATCHED AWAY            
FROM HIM IN KHERT-NETER. The Osiris Ani, whose word is truth,               
saith:- Get thee back, O messenger of every god! Art thou come to           
[snatch away] my heart-case which liveth? My heart-case which liveth        
shall not be given unto thee. [As] I advance, the gods hearken unto my      
propitiation [prayer] and they fall down on their faces [whilst]            
they are on their own land.                                                 
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu)                                                  
-                                                                           
  THE CHAPTER OF NOT ALLOWING THE HEART.... TO BE CARRIED AWAY DEAD IN      
KHERT-NETER. [Nu, whose word is truth, saith]:- My heart is with me,        
and it shall never come to pass that it be carried away. I am the Lord      
of Hearts, the slayer of the heart-case. I live in truth, I have my         
being therein. I am Horus, the Dweller in Hearts, [I am] in the             
Dweller in the body. I have life by my word, my heart hath being. My        
heart-case shall not be snatched away from me, it shall not be              
wounded, it shall not be put in restraint if wounds are inflicted upon      
me. [If] one take possession of it I shall have my being in the body        
of my father Keb and in the body of my mother Nut. I have not done          
that which is held in abomination by the gods. I shall not suffer           
defeat [for] my word is truth.                                              
                                                                            
NOT_LETTING_THE_HEART_CASE_BE_TAKEN                                         
-                                                                           
  THE CHAPTER OF NOT LETTING THE HEART-CASE OF A MAN BE TAKEN AWAY          
FROM HIM IN KHERT-NETER. The Osiris Ani saith:- Hail, ye who steal and      
crush heart-cases [and who make the heart of a man to go through its        
transformations according to his deeds: let not what he hath done harm      
him before you]. Homage to you, O ye Lords of Eternity, ye masters          
of everlastingness, take ye not this heart of Osiris Ani into your          
fingers, and this heart-case, and cause ye not things of evil to            
spring up against it, because this heart belongeth to the Osiris            
Ani, and this heart-case belongeth to him of the great names                
(Thoth), the mighty one, whose words are his members. He sendeth his        
heart to rule his body, and his heart is renewed before the gods.           
The heart of the Osiris Ani, whose word is truth, is to him; he hath        
gained the mastery over it. He hath not said what he hath done. He          
hath obtained power over his own members. His heart obeyeth him, he is      
the lord thereof, it is in his body, and it shall never fall away           
therefrom. I command thee to be obedient unto me in Khert-Neter. I,         
the Osiris Ani, whose word is truth, in peace; whose word is truth          
in the Beautiful Amentet, by the Domain of Eternity.                        
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu, Sheet 5)                                         
-                                                                           
  THE CHAPTER OF NOT LETTING THE HEART OF NU, WHOSE WORD IS TRUTH,          
BE CARRIED AWAY FROM HIM IN KHERT-NETER. He saith:- Hail, thou              
Lion-god! I am Unb (the Blossom). That which is held in abomination to      
me is the block of slaughter of the god. Let not this my heart-case be      
carried away from me by the Fighting Gods in Anu. Hail, thou who            
dost wind bandages round Osiris, and who hast seen Set. Hail, thou who      
returnest after smiting and destroying him before the mighty ones!          
This my heart weepeth over itself before Osiris; it hath made               
supplication for me. I have given unto him and I have dedicated unto        
him the thoughts of the heart in the House of the god (Usekh-her),          
have brought unto him sand at the entry to Khemenu. Let not this my         
heart-case be carried away from me. I make you to ascend his throne,        
to fetter heart-cases for him in Sekhet-hetep, [to live] years of           
strength away from things of all kinds which are abominations to            
him, to carry off food from among the things which are thine, and           
which are in thy grasp through thy strength. And this my heart-case is      
devoted to the decrees of the god Tem, who guideth me through the           
caverns of Suti, but let not this my heart, which hath performed its        
desire before the Tchatcha Chiefs who are in Khert-Neter, be given          
to him. When they find the leg and the swathings they bury them.            
-                                                                           
-                                                                           
  THE CHAPTER OF NOT LETTING THE HEART OF NU, WHOSE WORD IS TRUTH,          
BE DRIVEN AWAY FROM HIM IN KHERT-NETER. He saith:- My heart of my           
mother. My heart of my mother. My heart-case of my existence upon           
the earth. Let no one stand up against me when I bear testimony in the      
presence of the Lords of Things. Let it not be said against me and          
of that which I have done "He hath committed acts which are opposed to      
what is right and true," and let not charges be brought up against          
me in the presence of the Great God, the Lord of Amentet. Homage to         
thee, O my heart (ab). Homage to thee, O my heart-case. Homage to you,      
O my reins. Homage to you, O ye gods, who are masters of [your]             
beards, and who are holy by reason of your sceptres. Speak ye for me        
words of good import to Ra, and make ye me to have favour in the sight      
of Nehebkau.                                                                
                                                                            
BREATHING_THE_AIR                                                           
-                                                                           
  THE CHAPTER OF BREATHING THE AIR AND OF HAVING POWER OVER WATER IN        
KHERT-NETER. The Osiris Ani saith:- Open to me! Who art thou?               
Whither goest thou? What is thy name? I am one of you. Who are these        
with you? The two Merti goddesses (Isis and Nephthys). Thou separatest      
head from head when [he] entereth the divine Mesqen chamber. He             
causeth me to set out for the temple of the gods Kem-heru.                  
"Assembler of souls" is the name of my ferry-boat. "Those who make the      
hair to bristle" is the name of the oars. "Sert" ("Goad") is the            
name of the hold. "Steering straight in the middle" is the name of the      
rudder; likewise, [the boat] is a type of my being borne onward in the      
lake. Let there be given unto me vessels of milk, and cakes, and            
loaves of bread, and cups of drink, and flesh, in the Temple of Anpu.       
-                                                                           
  RUBRIC: If the deceased knoweth this Chapter, he shall go into,           
after coming forth from Khert-Neter of [the Beautiful Amentet].             
                                                                            
SNUFFING_THE_AIR_IN_KHERT_NETER                                             
-                                                                           
  THE CHAPTER OF SNUFFING THE AIR, AND OF HAVING POWER OVER THE             
WATER IN KHERT-NETER. The Osiris Ani saith:- Hail, thou Sycamore            
tree of the goddess Nut! Give me of the [water and of the] air which        
is in thee. I embrace that throne which is in Unu, and I keep guard         
over the Egg of Nekek-ur. It flourisheth, and I flourish; it liveth,        
and I live; it snuffeth the air, and I snuff the air, I the Osiris          
Ani, whose word is truth, in [peace].                                       
                                                                            
NOT_DYING_A_SECOND_TIME                                                     
-                                                                           
  THE CHAPTER OF NOT DYING A SECOND TIME IN KHERT-NETER. The Osiris         
Ani saith:- My hiding place is opened, my hiding place is opened.           
The Spirits fall headlong in the darkness, but the Eye of Horus hath        
made me holy, and Upuati hath nursed me. I will hide myself among you,      
O ye stars which are imperishable. My brow is like the brow of Ra.          
My face is open. My heart-case is upon its throne, I know how to utter      
words. In very truth I am Ra himself. I am not a man of no account.         
I am not a man to whom violence can be done. Thy father liveth for          
thee, O son of Nut. I am thy son, O great one, I have seen the              
hidden things which are thine. I am crowned upon my throne like the         
king of the gods. I shall not die a second time in Khert-Neter.             
                                                                            
NOT_ROTTING_IN_KHERT_NETER                                                  
-                                                                           
  THE CHAPTER OF NOT ROTTING IN KHERT-NETER. The Osiris Ani saith:-         
O thou who art motionless, O thou who art motionless, O thou whose          
members are motionless, like unto those of Osiris. Thy members shall        
not be motionless, they shall not rot, they shall not crumble away,         
they shall not fall into decay. My members shall be made [permanent]        
for me as if I were Osiris.                                                 
-                                                                           
  RUBRIC: If this Chapter be known by the deceased he shall never           
see corruption in Khert-Neter.                                              
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu, Sheet 18)                                        
-                                                                           
  THE CHAPTER OF NOT LETTING THE BODY PERISH. The Osiris Nu saith:-         
Homage to thee, O my divine father Osiris! I come to embalm thee. Do        
thou embalm these my members, for I would not perish and come to an         
end [but would be] even like unto my divine father Khepera, the divine      
type of him that never saw corruption. Come then, strengthen my             
breath, O Lord of the winds, who dost magnify these divine beings           
who are like unto thyself. Stablish me, stablish me, and fashion me         
strongly, O Lord of the funeral chest. Grant thou that I may enter          
into the land of everlastingness, according to that which was done for      
thee, along with thy father Tem, whose body never saw corruption,           
and who himself never saw corruption. I have never done that which          
thou hatest, nay, I have acclaimed thee among those who love thy KA.        
Let not my body become worms, but deliver thou me as thou didst             
deliver thyself. I pray thee, let me not fall into rottenness, as thou      
lettest every god, and every goddess, and every animal, and every           
reptile, see corruption, when the soul hath gone out of them, after         
their death.                                                                
  And when the soul hath departed, a man seeth corruption, and the          
bones of his body crumble away and become stinking things, and the          
members decay one after the other, the bones crumble into a helpless        
mass, and the flesh turneth into foetid liquid. Thus man becometh a         
brother unto the decay which cometh upon him, and he turneth into a         
myriad of worms, and he becometh nothing but worms, and an end is made      
of him, and perisheth in the sight of the god of day (Shu), even as do      
every god, and every goddess, and every bird, and every fish, and           
every creeping worm, and every reptile, and every beast, and every          
thing whatsoever. Let [all the Spirits fall] on their bellies [when]        
they recognize me, and behold, the fear of me shall terrify them;           
and thus also let it be with every being that hath died, whether it be      
animal, or bird, or fish, or worm, or reptile. Let life [rise out           
of] death. Let not the decay caused by any reptile make an end [of          
me], and let not [enemies] come against me in their various forms.          
Give thou me not over to the Slaughterer in this execution-chamber,         
who killeth the members, and maketh them rot, being [himself]               
invisible, and who destroyeth the bodies of the dead, and liveth by         
carnage. Let me live, and perform his order; I will do what is              
commanded by him. Give me not over to his fingers, let him not              
overcome me, for I am under thy command, O Lord of the Gods.                
  Homage to thee, O my divine father Osiris, thou livest with thy           
members. Thou didst not decay, thou didst not become worms, thou didst      
not wither, thou didst not rot, thou didst not putrefy, thou didst not      
turn into worms. I am the god Khepera, and my members shall have being      
everlastingly. I shall not decay, I shall not rot, I shall not              
putrefy, I shall not turn into worms, and I shall not see corruption        
before the eye of the god Shu. I shall have my being, I shall have          
by being; I shall live, I shall live; I shall flourish, I shall             
flourish, I shall flourish, I shall wake up in peace, I shall not           
putrefy, my intestines shall not perish, I shall not suffer injury. My      
eye shall not decay. The form of my face shall not disappear. My ear        
shall not become deaf. My head shall not be separated from my neck. My      
tongue shall not be removed. My hair shall not be cut off. My eyebrows      
shall not be shaved away, and no evil defect shall assail me. My            
body shall be stablished. It shall neither become a ruin, nor be            
destroyed on this earth.                                                    
                                                                            
NOT_PERISHING                                                               
-                                                                           
  THE CHAPTER OF NOT PERISHING AND OF BEING ALIVE IN KHERT-NETER.           
The Osiris Ani saith:- Hail ye children of the god Shu. The Tuat            
hath gained the mastery over his diadem. Among the Hamemet Spirits may      
I arise, even as did arise Osiris.                                          
                                                                            
NOT_GOING_TO_THE_BLOCK_OF_THE_GOD                                           
-                                                                           
  THE CHAPTER OF NOT GOING IN TO THE BLOCK OF THE GOD. The Osiris           
Ani saith:- My head was fastened on my body in heaven, O Guardian of        
the Earth, by Ra. [This] was granted [to me] on the day of my being         
stablished, when I rose up out of a state of weakness upon [my] two         
feet. On the day of cutting off the hair Set and the Company of the         
Gods fastened my head to my neck, and it became as firm as it was           
originally. Let nothing happen to shake it off again! Make ye me            
safe from the murderer of my father. I have tied together the Two           
Earths. Nut hath fastened together the vertebrae of my neck, and [I]        
behold them as they were originally, and they are seen in the order         
wherein they were when as yet Maat was not seen, and when the gods          
were not born in visible forms. I am Penti. I am the heir of the great      
gods, I the Osiris the scribe Ani, whose word is truth.                     
                                                                            
NOT_BEING_TRANSPORTED_TO_THE_EAST                                           
-                                                                           
  THE CHAPTER OF NOT BEING TRANSPORTED TO THE EAST IN KHERT-NETER. The      
Osiris Ani saith:- Hail, Phallus of Ra, which advanceth and beateth         
down opposition. Things which have been without motion for millions of      
years have come into life through Baba. I am stronger thereby than the      
strong, and I have more power thereby than the mighty. Now, let me not      
be carried away in a boat, or be seized violently and taken to the          
East, to have the festivals of Sebau Devils celebrated on me. Let           
not deadly wounds be inflicted upon me, and let me not be gored by          
horns. Thou shalt neither fall [nor] eat fish made by Tebun.                
-                                                                           
  Now, no evil thing of any kind whatsoever shall be done unto me by        
the Sebau Devils. [I shall not be gored by] horns. Therefore the            
Phallus of Ra, [which is] the head of Osiris, shall not be swallowed        
up. Behold, I shall come into me fields and I shall cut the grain. The      
gods shall provide me with food. Thou shalt not then be gored,              
Ra-Khepera. There shall not be then pus in the Eye of Tem, and it           
shall not be destroyed. Violence shall not be done unto me, and I           
shall not be carried away in [my] boat to the East to have the              
festivals of the Sebau Devils celebrated on me in evil fashion.             
Cruel gashes with knives shall not be inflicted upon me, and I shall        
not be carried away in [my] boat to the East. I the Osiris, the             
assessor of the holy offerings of all the gods, Ani, whose word is          
truth, happily, the lord of fealty [to Osiris].                             
                                                                            
NOT_LETTING_THE_HEAD_BE_CUT_OFF                                             
-                                                                           
  THE CHAPTER OF NOT LETTING THE HEAD OF A MAN BE CUT OFF FROM HIS          
BODY IN KHERT-NETER. The Osiris Ani saith:- I am a Great One, the           
son of a Great One. [I am] Fire, the son of Fire, to whom was given         
his head after it had been cut off. The head of Osiris was not removed      
from his body, and the head of Osiris Ani shall not be removed from         
his body. I have knitted myself together, I have made myself whole and      
complete. I shall renew my youth. I am Osiris Himself, the Lord of          
Eternity.                                                                   
                                                                            
UNITING_THE_SOUL_TO_ITS_BODY                                                
-                                                                           
  THE CHAPTER OF MAKING THE SOUL TO BE JOINED TO ITS BODY IN                
KHERT-NETER. The Osiris Ani saith:- Hail, thou god Aniu! Hail, thou         
god Pehreri, who dwellest in thy hall, the Great God. Grant thou            
that my soul may come to me from any place wherein it may be. Even          
if it would tarry, let my soul be brought unto me from any place            
wherein it may be. Thou findest the Eye of Horus standing by thee like      
unto those beings who resemble Osiris, who never lie down in death.         
Let not the Osiris Ani, whose word is truth, lie down dead among those      
who lie in Anu, the land wherein [souls] are joined to their bodies in      
thousands. Let me have possession of my Ba-soul and of my Spirit-soul,      
and let my word be truth with it (the Ba-soul) in every place               
wherein it may be. Observe then, O ye guardians of Heaven, my soul          
[wherever it may be]. Even if it would tarry, cause thou my Ba-soul to      
see my body. Thou shalt find the Eye of Horus standing by thee like         
[the Watchers].                                                             
  Hail, ye gods who tow along the boat of the Lord of Millions of           
Years, who bring it over the sky of the Tuat, who make it to journey        
over Nent, who make Ba-souls to enter into their Spirit-bodies,             
whose hands hold the steering poles and guide it straight, who grasp        
tightly your paddles, destroy ye the Enemy; thus shall the Boat             
rejoice, and the Great God shall travel on his way in peace. Moreover,      
grant ye that the Ba-soul of the Osiris Ani, whose word is truth            
before the gods, may come forth with your navel cords in the eastern        
part of the sky, and that it may follow Ra to the place where he was        
yesterday, and may set in peace, in peace in Amentet. May it gaze upon      
its earthly body, may it take up its abode and its Spirit-body, may it      
neither perish nor be destroyed for ever and for ever.                      
-                                                                           
  RUBRIC: These words shall be said over a model of the Ba-soul made        
of gold, and inlaid with precious stones, which shall be placed on the      
breast of the Osiris.                                                       
-                                                                           
                                                                            
NOT_LETTING_THE_SOUL_BE_HELD_CAPTIVE                                        
-                                                                           
  THE CHAPTER OF NOT LETTING THE SOUL OF A MAN BE HELD CAPTIVE IN           
KHERT-NETER. The Osiris Ani saith:- Hail, thou who art exalted!             
Hail, thou who art adored! Hail, Mighty One of Souls, thou divine Soul      
who inspirest great dread, who dost set the fear of thyself in the          
gods, who are enthroned upon thy mighty seat. Make thou a path for the      
Spirit-soul and the Ba-soul of the Osiris Ani. I am equipped with           
[words of power]. I am a Spirit-soul equipped with [words of power]. I      
have made my way to the place where are Ra and Hathor.                      
-                                                                           
  RUBRIC: If this Chapter be known by the deceased he shall be able to      
transform himself into a Spirit-soul who shall be equipped with [his        
soul and his shadow] in Khert-Neter, and he shall not be shut up            
inside any door in Amentet, when he is coming forth upon the Earth, or      
when he is going back into [Khert-Neter.]                                   
                                                                            
OPENING_THE_TOMB_TO_THE_BA_SOUL                                             
-                                                                           
  THE CHAPTER OF OPENING THE TOMB TO THE BA-SOUL AND THE SHADOW, AND        
OF COMING FORTH BY DAY, AND OF HAVING MASTERY OVER THE TWO LEGS. The        
Osiris the scribe Ani, whose word is truth, saith:- The place which is      
closed is opened, the place which is shut (or sealed) is sealed.            
That which lieth down in the closed place is opened by the Ba-soul          
which is in it. By the Eye of Horus I am delivered. Ornaments are           
stablished on the brow of Ra. My stride is made long. I lift up my two      
thighs [in walking]. I have journeyed over a long road. My limbs are        
in a flourishing condition. I am Horus, the Avenger of his Father, and      
I bring the Urrt Crown [and set it on] its standard. The road of souls      
is opened. My twin soul seeth the Great God in the Boat of Ra, on           
the day of souls. My soul is in the front thereof with the counter          
of the years. Come, the Eye of Horus hath delivered for me my soul, my      
ornaments are stablished on the brow of Ra. Light is on the faces of        
those who are in the members of Osiris. Ye shall not hold captive my        
soul. Ye shall not keep in durance my shadow. The way is open to my         
soul and to my shadow. It seeth the Great God in the shrine on the day      
of counting souls. It repeateth the words of Osiris. Those whose seats      
are invisible, who fetter the members of Osiris, who fetter                 
Heart-souls and Spirit-souls, who set a seal upon the dead, and who         
would do evil to me, shall do no evil to me. Haste on the way to me.        
Thy heart is with thee. My Heart-soul and my Spirit-soul are equipped;      
they guide thee. I sit down at the head of the great ones who are           
chiefs of their abodes. The wardens of the members of Osiris shall not      
hold thee captive, though they keep ward over souls, and set a seal on      
the shadow which is dead. Heaven shall not shut thee in.                    
-                                                                           
  RUBRIC: If this Chapter be known by the deceased he shall come forth      
by day, and his soul shall not be kept captive.                             
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papryus of Nebseni, Sheet 6)                                    
-                                                                           
  That which was shut hath been opened [that is] the dead. That             
which was shut fast hath been opened by the command of the Eye of           
Horus, which hath delivered me. Established are the beauties on the         
forehead of Ra. My steps are long. My legs are lifted up. I have            
performed the journey, my members are mighty and are sound. I am            
Horus, the Avenger of his Father. I am he who bringeth along his            
father, and his mother, by means of his staff. The way shall be opened      
to him that hath power over his feet, and he shall see the Great God        
in the Boat of Ra, when souls are counted therein at the bows, and          
when the years also are counted up. Grant that the Eye of Horus, which      
maketh the adornments of splendour to be firm on the forehead of Ra,        
may deliver my soul for me, and let darkness cover your faces, O ye         
who would imprison Osiris. O keep not captive my soul. O keep not ward      
over my shadow, but let a way be opened for my soul and my shadow, and      
let them see the Great God in the shrine on the day of the counting of      
souls, and let them hold converse with Osiris, whose habitations are        
hidden, and those who guard the members of Osiris, and who keep ward        
over the Spirit-souls, and who hold captive the shadows of the dead,        
and who would work evil against me, so that they shall [not] work evil      
against me. A way shall be for KA with thee, and thy soul shall be          
prepared by those who keep ward over the members of Osiris, and who         
hold captive the shadows of the dead. Heaven shall not keep thee fast,      
the earth shall not hold thee captive. Thou shalt not live with the         
beings who slay, but thou shalt be master of thy legs, and thou             
shalt advance to thy body straightway in the earth, [and to] those who      
belong to the shrine of Osiris and guard his members.                       
                                                                            
LIFTING_UP_THE_FEET_AND_APPEARING_ON_THE_EARTH                              
-                                                                           
  THE CHAPTER OF LIFTING UP THE FEET, AND OF COMING FORTH ON THE            
EARTH. The Osiris Ani saith:- Perform thy work, O Seker, perform thy        
work, O Seker, O thou who dwellest in thy circle, and who dwellest          
in my feet in Khert-Neter. I am he who sendeth forth light over the         
Thigh of heaven. I come forth in heaven. I sit down by the Light-god        
(Khu). O I am helpless. O I am helpless. I would walk. I am                 
helpless. I am helpless in the regions of those who plunder in              
Khert-Neter, I the Osiris Ani, whose word is truth, in peace.               
                                                                            
MAKING_A_WAY_THROUGH_AMENTET_BY_DAY                                         
-                                                                           
  THE CHAPTER OF FORCING A WAY INTO AMENTET [AND OF COMING FORTH] BY        
DAY. The Osiris Ani saith:- The town of Unu is opened. My head is           
sealed up, Thoth. Perfect is the Eye of Horus. I have delivered the         
Eye of Horus which shineth with splendours on the brow of Ra, the           
Father of the gods, [I am] that self-same Osiris, [the dweller in]          
Amentet. Osiris knoweth his day, and he knoweth that he shall live          
through his period of life; I shall have by being with him. I am the        
Moon-god Aah, the dweller among the gods. I shall not come to an            
end. Stand up therefore, O Horus, for thou art counted among the gods.      
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (Naville, op. cit., I, Bl. X)                                             
-                                                                           
  THE CHAPTER OF FORCING A WAY INTO THE TUAT. The Am Khent priest           
Nefer-uben-f, whose word is truth, saith:- Hail, Soul, thou mighty one      
of terror. Behold, I have come unto thee. I see thee. I have forced         
a way through the Tuat. I see my father Osiris. I drive away the            
darkness. I love him. I have come. I see my father Osiris. He hath          
counted the heart of Set. I have made offerings for my father               
Osiris. I have opened all the ways in heaven and on earth. I love him.      
I have come. I have become a Spirit-body and a Spirit-soul, who is          
equipped. Hail, every god and every Spirit-soul, I have made the ways.      
I am Thoth....                                                              
-                                                                           
-                                                                           
  ANOTHER CHAPTER OF THE TUAT AND OF COMING FORTH BY DAY.                   
-                                                                           
                                                     {APPENDIX ^paragraph 5}
  Open is the land of Unu. Shut is the head of Thoth. Perfect is the        
Eye of Horus. I have delivered the Eye of Horus, the shining one,           
the ornament of the Eye of Ra, the Father of the Gods. I am that            
same Osiris who dwelleth in Amentet. Osiris knoweth his day, which          
cometh to an end. I am Set, the Father of the Gods. I shall never come      
to an end.                                                                  
                                                                            
COMING_FORTH_BY_DAY_&_LIVING_AFTER_DEATH                                    
-                                                                           
  THE CHAPTER OF COMING FORTH BY DAY AND OF LIVING AFTER DEATH. The         
Osiris Ani saith:- Hail, thou One, who shinest from the moon. Hail,         
thou One, who shinest from the moon. Grant that this Osiris Ani may         
come forth among thy multitudes who are at the portal. Let him be with      
the Light-God. Let the Tuat be opened to him. Behold, the Osiris Ani        
shall come forth by day to perform everything which he wisheth upon         
the earth among those who are living [thereon].                             
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu, Sheet 13)                                        
-                                                                           
  Hail, thou god Tem, who comest forth from the Great Deep, who             
shinest gloriously under the form of the twin Lion-gods, send forth         
with might thy words unto those who are in thy presence, and let the        
Osiris Nu enter into their assembly. He hath performed the decree           
which hath been spoken to the mariners at eventide, and the Osiris Nu,      
whose word is truth, shall live after his death, even as doth Ra every      
day. Behold, most certainly Ra was born yesterday, and the Osiris Nu        
was born yesterday. And every god shall rejoice in the life of the          
Osiris Nu, even as they rejoice in the life of Ptah, when he appeareth      
from the Great House of the Aged One which is in Anu.                       
                                                                            
COMING_FORTH_AFTER_PASSING_THROUGH_THE_AAMHET                               
-                                                                           
  THE CHAPTER OF COMING FORTH BY DAY AFTER FORCING AN ENTRANCE THROUGH      
THE AAMHET. The Osiris Ani saith:- Hail, Soul, thou mighty one of           
terror! Verily, I am here. I have come. I behold thee. I have passed        
through the Tuat. I have seen Father Osiris. I have scattered the           
gloom of night. I am his beloved one. I have come, I have seen my           
Father Osiris. I have stabbed the heart of Suti. I have made offerings      
to my Father Osiris. I have opened every way in heaven and on the           
earth. I am the son who loveth his Fathers (sic) Osiris. I am a             
Spirit-body. I am a Spirit-soul. I am equipped. Hail, every god and         
every Spirit-soul. I have made the way [to Osiris]. I the Osiris the        
scribe Ani, whose word is truth.                                            
                                                                            
MAKING_MAN_TO_RETURN_TO_LOOK_UPON_HIS_HOUSE                                 
-                                                                           
  THE CHAPTER OF MAKING A MAN TO RETURN TO LOOK UPON HIS HOUSE ON           
EARTH. The Osiris Ani saith:- I am the Lion-god who cometh forth            
with long strides. I have shot arrows, and I have wounded my prey. I        
have shot arrows, and I have wounded my prey. I am the Eye of Horus, I      
traverse the Eye of Horus at this season. I have arrived at the             
domains. Grant that the Osiris Ani may come in peace.                       
                                                                            
MAN_COMING_FORTH_BY_DAY_AGAINST_HIS_ENEMIES                                 
-                                                                           
  ANOTHER CHAPTER OF THE COMING FORTH OF A MAN BY DAY AGAINST HIS           
ENEMIES IN KHERT-NETER. [The Osiris Ani saith:-] I have divided the         
heavens. I have cleft the horizon. I have traversed the earth               
[following in] his footsteps. I have conquered the mighty Spirit-souls      
because I am equipped for millions of years with words of power. I eat      
with my mouth. I evacuate with my body. Behold, I am the God of the         
Tuat! Let these things be given unto me, the Osiris Ani, in perpetuity      
withou fail or diminution.                                                  
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu, Sheet 21)                                        
-                                                                           
  THE CHAPTER OF COMING FORTH AGAINST ENEMIES IN KHERT-NETER. The           
Osiris Nu saith:- Hail, Am-a-f (Eater of his arm), I have passed            
over the road. I am Ra. I have come forth from the horizon against          
my enemies. I have not permitted him to escape from me. I have              
stretched out my hand like that of the Lord of the Urrt Crown. I            
have lifted up my feet even as the Uraei-goddesses lift themselves up.      
I have not permitted the enemy [to be saved] from me. As for mine           
enemy, he hath been given to me, and he shall not be delivered from         
me. I stand up like Horus. I sit down like Ptah. I am strong like           
Thoth. I am mighty like Tem. I walk with my legs. I speak with my           
mouth. I chase my enemy. He hath been given unto me, and he shall           
not be delivered from me.                                                   
                                                                            
HYMN_TO_RA_WHEN_HE_RISETH_AND_SETTETH                                       
-                                                                           
  A HYMN OF PRAISE TO RA WHEN HE RISETH UPON THE HORIZON, AND WHEN          
HE SETTETH IN THE LAND OF LIFE. Osiris the scribe Ani saith:- Homage        
to thee, O Ra, when thou risest as Tem-Heru-Khuti. Thou art to be           
adored. Thy beauties are before mine eyes, [thy] radiance is upon my        
body. Thou goest forth to thy setting in the Sektet Boat with [fair]        
winds, and thy heart is glad; the heart of the Matet Boat rejoiceth.        
Thou stridest over the heavens in peace, and all thy foes are cast          
down; the stars which never rest sing hymns of praise unto thee, and        
the stars which are imperishable glorify thee as thou sinkest to            
rest in the horizon of Manu, O thou who art beautiful at morn and at        
eve, O thou lord who livest, and art established, O my Lord!                
  Homage to thee, O thou who art Ra when thou risest, and who art           
Tem when thou settest in beauty. Thou risest and thou shinest on the        
back of thy mother [Nut], O thou who art crowned the king of the gods!      
Nut welcometh thee, and payeth homage unto thee, and Maat, the              
everlasting and never-changing goddess, embraceth thee at noon and          
at eve. Thou stridest over the heavens, being glad at heart, and the        
Lake of Testes is content. The Sebau-fiend hath fallen to the               
ground, his fore-legs and his hind-legs have been hacked off him,           
and the knife hath severed the joints of his back. Ra hath a fair           
wind, and the Sektet Boat setteth out on its journey, and saileth on        
until it cometh into port. The gods of the South, the gods of the           
North, the gods of the West, and the gods of the East praise thee, O        
thou Divine Substance, from whom all living things came into being.         
Thou didst send forth the word when the earth was submerged with            
silence, O thou Only One, who didst dwell in heaven before ever the         
earth and the mountains came into being. Hail, thou Runner, Lord, Only      
One, thou maker of the things that are, thou hast fashioned the tongue      
of the Company of the Gods, thou hast produced whatsoever cometh forth      
from the waters, thou springest up out of them above the submerged          
land of the Lake of Horus. Let me breathe the air which cometh forth        
from thy nostrils, and the north wind which cometh forth from thy           
mother Nut. Make thou my Spirit-soul to be glorious, O Osiris, make         
thou my Heart-soul to be divine. Thou art worshipped as thou                
settest, O Lord of the gods, thou art exalted by reason of thy              
wondrous works. Shine thou with the rays of light upon my body day          
by day, upon me, Osiris the scribe, the assessor of the divine              
offerings of all the gods, the overseer of the granary of the Lords of      
Abydos, the real royal scribe who loveth thee, Ani, whose word is           
truth, in peace.                                                            
  Praise be unto thee, O Osiris, the Lord of Eternity, Un-Nefer,            
Heru-Khuti (Harmakhis), whose forms are manifold, whose attributes are      
majestic [Praise be unto thee], O thou who art Ptah-Seker-Tem in            
Anu, thou Lord of the hidden shrine, thou Creator of the House of           
the KA of Ptah (Het-ka-Ptah) and of the gods [therein], thou Guide          
of the Tuat, who art glorified when thou settest in Nu (the Sky). Isis      
embraceth thee in peace, and she driveth away the fiends from the           
entrances of thy paths. Thou turnest thy face towards Amentet, and          
thou makest the earth to shine as with refined copper. Those who            
have lain down in death rise up to see thee, they breathe the air, and      
they look upon thy face when the disk riseth on the horizon. Their          
hearts are at peace since they behold thee, o thou who art Eternity         
and Everlastingness.                                                        
                                                                            
THE_SOLAR_LITANY                                                            
  THE SOLAR LITANY                                                          
-                                                                           
  Homage to you, O ye gods of the Dekans in Anu, and to you, O ye           
Hememet-spirits in Kher Aha, and to thee, O Unti, who art the most          
glorious of all the gods who are hidden in Anu,                             
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
-                                                                           
  Homage to thee, O An in Antes, Heru-khuti, who dost with long             
strides march across the heavens,                                           
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
                                             {THE_SOLAR_LITANY ^paragraph 5}
-                                                                           
  Homage to thee, O Everlasting Soul, thou Soul who dwellest in             
Tetu, Un-Nefer, the son of Nut, who art the Lord of Akert,                  
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have done      
aught with deceit.                                                          
-                                                                           
  Homage to thee in thy dominion over Tetu, upon whose brow the Urrt        
Crown is established, thou One who createst the strength to protect         
thyself, and who dwellest in peace,                                         
                                            {THE_SOLAR_LITANY ^paragraph 10}
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
-                                                                           
  Homage to thee, O Lord of the Acacia Tree, whose Seker Boat is set        
upon its sledge, who turnest back the Fiend, the Evildoer, and dost         
cause the Eye of Ra (utchat) to rest upon its seat,                         
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
-                                                                           
                                            {THE_SOLAR_LITANY ^paragraph 15}
  Homage to thee, O thou who art mighty in thine hour, thou great           
and mighty Prince who dost dwell in Anrutef, thou Lord of Eternity and      
Creator of the Everlastingness, thou Lord of Hensu,                         
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
-                                                                           
  Homage to thee, O thou who restest upon Truth, thou Lord of Abtu,         
whose limbs form the substance of Ta-tchesert, unto whom fraud and          
deceit are abominations,                                                    
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
                                            {THE_SOLAR_LITANY ^paragraph 20}
-                                                                           
  Homage to thee, O thou who dwellest in thy boat, who dost bring Hapi      
(the Nile) forth from his cavern, whose body is the light, and who          
dwellest in Nekhen,                                                         
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
-                                                                           
  Homage to thee, O thou Creator of the gods, thou King of the South        
and North, Osiris, whose word is truth, who rulest the world by thy         
gracious goodness, thou Lord of the Atebui,                                 
                                            {THE_SOLAR_LITANY ^paragraph 25}
  O grant thou unto me a path whereover I may pass in peace, for I          
am just and true; I have not spoken falsehood wittingly, nor have I         
done aught with deceit.                                                     
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Saite Recension, ed. Lepsius, Bl. V)                            
-                                                                           
  Homage to thee, O thou who comest as Tem, who didst come into             
being to create the Company of the Gods.                                    
  Homage to thee, O thou who comest as the Soul of Souls, the Holy One      
in Amentet.                                                                 
  Homage to thee, O President of the Gods, who illuminest the Tuat          
with thy beauties.                                                          
  Homage to thee, O thou who comest as the Light-god, who travellest        
in thy Disk.                                                                
                                                     {APPENDIX ^paragraph 5}
  Homage to thee, O thou greatest of all gods, who are crowned King in      
heaven, Governor in the Tuat.                                               
  Homage to thee, O thou who makest a way through the Tuat, who dost        
lead the way through all doors.                                             
  Homage to thee, O thou who art among the gods, who dost weigh             
words in Khert-Neter.                                                       
  Homage to thee, O thou who dwellest in thy secret places, who dost        
fashion the Tuat with thy might.                                            
  Homage to thee, O great one, O mighty one, thine enemies have fallen      
in places where they were smitten.                                          
                                                    {APPENDIX ^paragraph 10}
  Homage to thee, O thou who hast hacked the Sebau-fiends in pieces,        
and hast annihilated Aapep.                                                 
  Grant thou the sweet breeze of the north wind to the Osiris               
Auf-ankh, whose word is truth.                                              
                                                                            
HYMN_TO_RA_WHEN_HE_RISETH_AND_TO_THOSE_IN_HIS_TRAIN                         
-                                                                           
  A HYMN OF PRAISE TO RA WHEN HE RISETH IN THE EASTERN PART OF HEAVEN.      
Those who are in his following rejoice, and the Osiris, the scribe          
Ani, whose word is truth, saith:- Hail, thou Disk, thou lord of             
rays, who risest on the horizon day by day. Shine thou with thy             
beams of light upon the face of the Osiris Ani, whose word is truth,        
for he singeth hymns of praise to thee at dawn, and he maketh thee          
to sit at eventide [with words of adoration]. May the soul of the           
Osiris Ani, whose word is truth, come forth with thee into heaven! May      
he set out with thee in the Matet Boat [in the morning], may he come        
into port in the Sektet Boat [in the evening], and may he cleave his        
path among the stars of heaven which never rest.                            
  The Osiris Ani, whose word is truth, being at peace [with his             
god], maketh adoration to his Lord, the Lord of Eternity, and               
saith:- Homage to thee, O Heru-khuti, who art the god Khepera, the          
self-created. When thou risest on the horizon and sheddest thy beams        
of light upon the Lands of the South and of the North, thou art             
beautiful, yea beautiful, and all the gods rejoice when they behold         
thee, the king of heaven. The goddess, the Lady of the Hour, is             
stablished upon thy head, her Uraei of the South and of the North           
are upon thy brow, and she taketh up her place before thee. The god         
Thoth is stablished in the bows of thy boat to destroy utterly all thy      
foes. Those who dwell in the Tuat come forth to meet thee, and they         
bow to the earth in homage as they come towards thee, to look upon thy      
beautiful Form. And I, Ani, have come into thy presence, so that I may      
be with thee, and may behold thy Disk every day. Let me not be kept         
captive [by the tomb], and let me not be turned back [on my way].           
Let the members of my body be made new again when I contemplate thy         
beauties, even as are the members of all thy favoured ones, because         
I am one of those who worshipped thee upon earth. Let me arrive in the      
Land of Eternity, let me enter into the Land of Everlastingness. This,      
O my Lord, behold thou shalt ordain for me.                                 
  AND MOREOVER, THE OSIRIS ANI, WHOSE WORD IS TRUTH, IN PEACE, THE          
TRUTH-SPEAKER, SAITH:- Homage to thee, O thou who risest on thy             
horizon in the form of Ra, who restest upon Law, [which can neither be      
changed nor altered]. Thou passest over the sky, and every face,            
watcheth thee and thy course, for thou thyself art hidden from their        
gaze. Thou dost show thyself [to them] at dawn and at eventide each         
day. The Sektet Boat, wherein Thy Majesty dwelleth, setteth forth on        
its journey with vigour. Thy beams [fall] upon all faces, thy light         
with its manifold colours is incomprehensible [to man], and thy             
brilliant rays cannot be reported. The Lands of the Gods see thee,          
they could write [concerning thee]; the Deserts of Punt could count         
thee. Thy creation is hidden. It is one by the opening of thy mouth.        
Thy form is the head of Nu. May he (Ani) advance, even as thou dost         
advance, without cessation, even as Thy Majesty [ceaseth not to             
advance] even for a moment. With great strides thou dost in one little      
moment pass over limitless distances which would need millions and          
hundreds of thousands of years [for a man to pass over; this] thou          
doest, and then thou sinkest to rest. Thou bringest to an end the           
hours of the night, even as thou stridest over them. Thou bringest          
them to an end by thine own ordinance, and dawn cometh on the earth.        
Thou settest thyself before thy handiwork in the form of Ra, and            
thou rollest up on the horizon....... Thou sendest forth light when         
thy form raiseth itself up, thou ordainest the increase of thy              
splendours. Thou mouldest thy limbs as thou advancest, thou bringest        
them forth, thou who wast never brought forth, in the form of Ra,           
who rolleth up into the height of heaven. Grant thou that I may             
reach the heaven of eternity, and the region where thy favoured ones        
dwell. May I unite with those holy and perfect Spirit-souls of              
Khert-Neter. May I come forth with them to behold thy beauties as thou      
rollest on at eventide, as thou journeyest to thy mother Nut (the           
Night-sky), and dost place thyself at the right hand (in the West). My      
two hands are raised to thee in praise and thanksgiving when thou           
settest in life. Behold, thou art the Creator of Eternity, who art          
adored when thou settest in Nu. I have set thee in my heart, without        
wavering, O thou who art more divine than the gods.                         
  The Osiris Ani, whose word is truth, saith:- Praise and thanksgiving      
be unto thee, O thou who rollest on like unto gold, thou Illuminer          
of the Two Lands on the day of thy birth. Thy mother brought thee           
forth on her hand, and thou didst light up with splendour the circle        
which is travelled over by the Disk. O Great Light who rollest              
across Nu, thou dost raise up the generations of men from the deep          
source of thy waters, and dost make to keep festivals all districts         
and cities, and all habitations. Thou protectest [them] with thy            
beauties. Thy KA riseth up with the celestial food hu and tchefau. O        
thou mightily victorious one, thou Power of Powers, who makest              
strong thy throne against the sinful ones, whose risings on thy throne      
in the Sektet Boat are mighty, whose strength is widespread in the          
Atett Boat, make thou the Osiris Ani to be glorious by virtue of his        
word, which is truth, in Khert-Neter. Grant thou that he may be in          
Amentet free from evil, and let [his] offences be [set] behind thee.        
Grant thou that he may [live there] a devoted slave of the                  
Spirit-souls. Let him mingle among the Heart-souls who live in              
Ta-tchesert (the Holy Land). Let him travel about in the Sekhet-Aaru        
(the Elysian Fields), conformably to [thy] decree with joy of heart-        
him the Osiris Ani, whose word is truth.                                    
  [And the god maketh answer]:--Thou shalt come forth into heaven,          
thou shalt sail over the sky, and thou shalt hold loving intercourse        
with the Star-gods. Praises shall be made to thee in the Boat. Thy          
name shall be proclaimed in the Atett Boat. Thou shalt look upon Ra         
within his shrine. Thou shalt make the Disk to set [with prayer] every      
day. Thou shalt see the Ant Fish in his transformations in the              
depths of the waters of turquoise. Thou shalt see the Abtu Fish in his      
time. It shall be that the Evil One shall fall when he deviseth a plan      
to destroy thee, and the joints of his neck and back shall be hacked        
asunder. Ra saileth with a fair wind, and the Sektet Boat                   
progresseth and cometh into port. The mariners of Ra rejoice, and           
the heart of the Lady of the Hour is glad, for the enemy of her Lord        
hath been cast to the ground. Thou shalt behold Horus standing on           
the pilot's place in the Boat, and Thoth and Maat shall stand one on        
each side of him. All the gods shall rejoice when they behold Ra            
coming in peace to make the hearts of the Spirit-souls to live, and         
the Osiris Ani, whose word is truth, the assessor of the holy               
offerings of the Lords of Thebes, shall be with them!                       
                                                                            
THE_NEW_MOON                                                                
  THE CHAPTER OF THE NEW MOON                                               
-                                                                           
  THE FOLLOWING IS TO BE RECITED ON THE DAY OF THE MONTH (NEW MOON          
DAY). The Osiris the scribe Ani, whose word is truth, in peace,             
whose word is truth, saith:- Ra ascendeth his throne on his horizon,        
and the Company of his Gods follow in his train. The God cometh             
forth from his hidden place, [and] tchefau food falleth from the            
eastern horizon of heaven at the word of Nut. They (the gods)               
rejoice over the paths of Ra, the Great Ancestor [as] he journeyeth         
round about. Therefore art thou exalted, O Ra, the dweller in thy           
Shrine. Thou swallowest the winds, thou drawest into thyself the north      
wind, thou eatest up the flesh of thy seat on the day when thou             
breathest truth. Thou dividest [it among] the gods who are [thy]            
followers. [Thy] Boat saileth on travelling among the Great Gods at         
thy word. Thou countest thy bones, thou gatherest together thy              
members, thou settest thy face towards Beautiful Amentet, and thou          
comest there, being made new every day. Behold, thou art that Image of      
Gold, thou hast the unitings of the disks of the sky, thou hast             
quakings, thou goest round about, and art made new each day. Hail!          
There is rejoicing in the horizon! The gods who dwell in the sky            
descend the ropes [of thy Boat] when they see the Osiris Ani, whose         
word is truth, they ascribe praise unto him as unto Ra. The Osiris Ani      
is a Great Chief. [He] seeketh the Urrt Crown. His provisions are           
apportioned to him- the Osiris Ani, whose word is truth. [His] fate is      
strong from the exalted body of the Aamu gods, who are in the presence      
of Ra. The Osiris Ani, whose word is truth, is strong on the earth and      
in Khert-Neter. O Osiris Ani, whose word is truth, wake up, and be          
strong like unto Ra every day. The Osiris Ani, whose word is truth,         
shall not tarry, he shall not remain motionless in this land for ever.      
Right well shall he see with his two eyes, right well shall he hear         
with his two ears, the things which are true, the things which are          
true. The Osiris Ani, whose word is truth, is in Anu, the Osiris            
Ani, whose word is truth, is as Ra, and he is exalted by reason of          
[his] oars among the Followers of Nu. The Osiris Ani, whose word is         
truth, cannot tell what he hath seen [or] narrate [what he hath heard]      
in the House of the God of Mysteries. Hail! Let there be shouts of          
acclamation of the Osiris Ani, whose word is truth, the divine body of      
Ra in the Boat of Nu, who beareth propitiatory offerings for the KA of      
the god of that which he loveth. The Osiris Ani, whose word is              
truth, in peace, whose word is truth, is like Horus, the mighty one of      
transformations.                                                            
-                                                                           
  RUBRIC: This Chapter is to be recited over a boat seven cubits long,      
made of green stone of the Tchatchau. Make a heaven of stars, and           
purify it and cleanse it with natron and incense. Make then a figure        
of Ra upon a tablet of new stone in paint, and set it in the bows of        
the boat. Then make a figure of the deceased whom thou wilt make            
perfect, [and place it] in the boat. Make it to sail in the Boat of         
Ra, and Ra himself shall look upon it. Do not these things in the           
presence of any one except thyself, or thy father, or thy son. Then         
let them keep guard over their faces, and they shall see the                
deceased in Khert-Neter in the form of a messenger of Ra.                   
                                                                            
HYMN_TO_RA_FOR_THE_DAY_OF_THE_NEW_MOON                                      
-                                                                           
  A HYMN TO RA [WHICH IS TO BE SUNG] ON THE DAY OF THE MONTH (THE           
DAY OF THE NEW MOON) [WHEN] THE BOAT OF RA SAILETH. [The Osiris the         
scribe Ani, whose word is truth, saith:-] Homage to thee, O thou who        
dwellest in thy Boat. Thou rollest on, thou rollest on, thou sendest        
forth light, thou sendest forth light. Thou decreest rejoicing for          
[every] man for millions of years unto those who love him. Thou givest      
[thy] face to the Hememet spirits, thou god Khepera who dwellest in         
thy Boat. Thou hast overthrown the Fiend Aapep. O ye Sons of Keb,           
overthrow ye the enemies of the Osiris Ani, whose word is truth, and        
the fiends of destruction who would destroy the Boat of Ra. Horus hath      
cut off your heads in heaven. Ye who were in the forms of geese,            
your navel strings are on the earth. The animals are set upon the           
earth..... in the form of fish. Every male fiend and every female           
fiend shall be destroyed by the Osiris Ani, whose word is truth.            
Whether the fiends descend from out of heaven, or whether they come         
forth from the earth, or whether they advance on the waters, or             
whether they come from among the Star-gods, Thoth, [the son of              
Aner], coming forth from Anerti shall hack them to pieces. And the          
Osiris Ani shall make them silent and dumb. And behold ye, this god,        
the mighty one of slaughters, the terror of whom is most great,             
shall wash himself clean in your blood, and he shall bathe in your          
gore, and ye shall be destroyed by the Osiris Ani in the Boat of his        
Lord Ra-Horus. The heart of the Osiris Ani, whose word is truth, shall      
live. His mother Isis giveth birth to him, and Nephthys nurseth him,        
just as Isis gave birth to Horus, and Nephthys nursed him. [He]             
shall repulse the Smait fiends of Suti. They shall see the Urrt             
Crown stablished upon his head, and they shall fall down upon their         
faces [and worship him]. Behold, O ye Spirit-souls, and men, and gods,      
and ye dead, when ye see the Osiris Ani, whose word is truth, in the        
form of Horus, and the favoured one of the Urrt Crown, fall ye down         
upon your faces. The word of the Osiris Ani is truth before his             
enemies in heaven above, and on earth beneath, and before the               
Tchatchau Chiefs of every god and of every goddess.                         
-                                                                           
  RUBRIC: This Chapter shall be recited over a large hawk standing          
upright with the White Crown upon his head, [and over figures of] Tem,      
Shu, Tefnut, Keb, Nut, Osiris, Isis, [Suti] and Nephthys. And they          
shall be painted in colour upon a new tablet, which shall be placed in      
a boat, together with a figure of the deceased. Anoint them with heken      
oil, and offer unto them burning incense, and geese, and joints of          
meat roasted. It is an act of praise to Ra as he journeyeth in his          
boat, and it will make a man to have his being with Ra, and to              
travel with him wheresoever he goeth, and it will most certainly cause      
the enemies of Ra to be slain. And the Chapter of travelling shall          
be recited on the sixth day of the festival.                                
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Turin Papyrus)                                                  
-                                                                           
  ANOTHER CHAPTER WHICH IS TO BE RECITED WHEN THE MOON RENEWETH ITSELF      
ON THE DAY OF THE MONTH [WHEREON IT DOETH THIS]. Osiris unfettereth         
the storm-cloud in the body of heaven, and is unfettered himself;           
Horus is made strong happily each day. He whose transformations are         
many hath had offerings made unto him at the moment, and he hath            
made an end of the storm which is in the face of the Osiris, Auf-ankh,      
whose word is truth. Verily, he cometh, and he is Ra in journeying,         
and he is the four celestial gods in the heavens above. The Osiris          
Auf-ankh, whose word is truth, cometh forth in his day, and he              
embarketh among the tackle of the boat.                                     
-                                                                           
  RUBRIC: If this Chapter be known by the deceased he shall become a        
perfect Spirit-soul in Khert-Neter, and he shall not die a second           
time, and he shall eat his food side by side with Osiris. If this           
Chapter be known by the deceased upon earth, he shall become like unto      
Thoth, and he shall be adored by those who live. He shall not fall          
headlong at the moment of the intensity of the royal flame of the           
goddess Bast, and the Great Prince shall make him to advance happily.       
                                                                            
ADVANCING_TO_THE_TCJATCHAU_CHIEFS_OF_OSIRIS                                 
-                                                                           
  THE CHAPTER OF ADVANCING TO THE TCHATCHAU CHIEFS OF OSIRIS. The           
Osiris Ani, whose word is truth, saith:- I have built a house for my        
Ba-soul in the sanctuary in Tetu. I sow seed in the town of Pe (Buto).      
I have ploughed the fields with my labourers. My palm tree [standeth        
upright and is] like Menu upon it. I abominate abominable things. I         
will not eat the things which are abominations unto me. What I              
abominate is filth: I will not eat it. I shall not be destroyed by the      
offerings of propitiation and the sepulchral meals. I will not              
approach filth [to touch it] with my hands, I will not tread upon it        
with my sandals. For my bread shall be made of the white barley, and        
my ale shall be made from the red grain of the god Hapi (the                
Nile-god), which the Sektet Boat and the Atett Boat shall bring             
[unto me], and I will eat my food under the leaves of the trees             
whose beautiful arms I myself do know. O what splendour shall the           
White Crown make for me which shall be lifted up on me by the               
Uraei-goddesses! O Doorkeeper of Sehetep-taui, bring thou to me that        
wherewith the cakes of propitiation are made. Grant thou to me that         
I may lift up the earth. May the Spirit-souls open to me [their] arms,      
and let the Company of the Gods hold their peace whilst the Hememet         
spirits hold converse with the Osiris Ani. May the hearts of the            
gods lead him in his exalted state into heaven among the gods who           
appear in visible forms. If any god, or any goddess, attack the Osiris      
Ani, whose word is truth, when he setteth out, the Ancestor of the          
year who liveth upon hearts [Osiris] shall eat him when he cometh           
forth from Abydos, and the Ancestors of Ra shall reckon with him,           
and the Ancestors of Light shall reckon with him. [He is] a god of          
splendour [arrayed in] the apparel of heaven, and he is among the           
Great Gods. Now the subsistence of the Osiris Ani, whose word is            
truth, is among the cakes and the ale which are made for your               
mouths. I enter in by the Disk, I come forth by the god Ahui. I             
shall hold converse with the Followers of the Gods. I shall hold            
converse with the Disk. I shall hold converse with the                      
Hememet-spirits. He shall set the terror of me in the thick                 
darkness, in the inside of the goddess Mehurt, by the side of his           
forehead. Behold, I shall be with Osiris, and my perfection shall be        
his perfection among the Great Gods. I shall speak unto him with the        
words of men, I shall listen, and he shall repeat to me the words of        
the gods. I, the Osiris Ani, whose word is truth, in peace, have            
come equipped. Thou makest to approach [thee] those who love thee. I        
am a Spirit-soul who is better equipped than any [other] Spirit-soul.       
                                                                            
CHANGING_INTO_A_SWALLOW                                                     
-                                                                           
  THE CHAPTER OF MAKING THE TRANSFORMATION INTO A SWALLOW. The              
Osiris Ani, whose word is truth, saith:- I am a swallow, [I am] a           
swallow. [I am] that Scorpion, the daughter of Ra. Hail, O ye gods          
whose odour is sweet. Hail, O ye gods whose odour is sweet. Hail,           
Flame, who comest forth from the horizon. Hail, thou who art in the         
city. I have brought the Warder of his corner there. Give me thy two        
hands, and let me pass my time in the Island of Flame. I have advanced      
with a message, I have come having the report thereof [to make].            
Open to me. How shall I tell that which I have seen there? I am like        
Horus, the governor of the Boat, when the throne of his father was          
given unto him, and when Set, that son of Nut, was [lying] under the        
fetters which he had made for Osiris. He who is in Sekhem hath              
inspected me. I stretch out my arms over Osiris. I have advanced for        
the examination, I have come to speak there. Let me pass on and             
deliver my message. I am he who goeth in, [I am] judged, [I] come           
forth magnified at the Gate of Nebertcher. I am purified at the             
Great Uart. I have done away my wickednesses. I have put away               
utterly my offences. I have put away utterly all the taints of evil         
which appertained to me [upon the earth]. I have purified myself, I         
have made myself to be like a god. Hail, O ye Doorkeepers, I have           
completed my journey. I am like unto you. I have come forth by day.         
I have advanced on my legs. I have gained the master over [my]              
footsteps. [Hail, ye] Spirit-souls! I, even I, do know the hidden           
roads and the Gates of Sekhet Aaru. I live there. Verily, I, even I,        
have come, I have overthrown my enemies upon the earth, although my         
body lieth a mummy in the tomb.                                             
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
-                                                                           
  RUBRIC: (Naville, op. cit., II, Bl. 202)                                  
  If this Chapter be known by the deceased, he shall enter in after he      
hath come forth by day.                                                     
-                                                                           
  RUBRIC: (Saite Recension)                                                 
  If this Chapter be known by the deceased, he shall come forth by day      
from Khert-Neter, and he shall go [again] after he hath come forth. If      
this Chapter be not known [by the deceased], he shall not go in             
again after he hath come forth [and he] shall not know [how] to come        
forth by day.                                                               
                                                                            
CHANGING_INTO_A_HAWK_OF_GOLD                                                
-                                                                           
  [THE CHAPTER] OF MAKING THE TRANSFORMATION INTO A HAWK OF GOLD.           
The Osiris Ani saith:- I have risen up out of the seshett chamber,          
like the golden hawk which cometh forth from his egg. I fly, I              
alight like a hawk with a back of seven cubits, and the wings of which      
are like unto the mother-of-emerald of the South. I have come forth         
from the Sektet Boat, and my heart hath been brought unto me from           
the mountain of the East. I have alighted on the Atet Boat, and             
there have been brought unto me those who dwelt in their substance,         
and they bowed in homage before me. I have risen, I have gathered           
myself together like a beautiful golden hawk, with the head of the          
Benu, and Ra hath entered in [to hear my speech]. I have taken my seat      
among the great gods, [the children of] Nut. I have settled myself,         
the Sekhet-hetepet (the Field of Offerings) is before me. I eat             
therein, I become a Spirit-soul therein, I am supplied with food in         
abundance therein, as much as I desire. The Grain-god (Nepra) hath          
given unto me food for my throat, and I am master over myself and over      
the attributes of my head.                                                  
                                                                            
CHANGING_INTO_A_DIVINE_HAWK                                                 
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO A DIVINE HAWK. The        
Osiris Ani saith:- Hail, thou Great God, come thou to Tetu. Make            
thou ready for me the ways, and let me go round [to visit] my thrones.      
I have laboured. I have made myself perfect. O grant thou that I may        
be held in fear. Create thou awe of me. Let the gods of the Tuat be         
afraid of me, and let them fight for me in their halls. Permit not          
thou to come nigh unto me him that would attack me, or would injure me      
in the House of Darkness. Cover over the helpless one, hide him. Let        
do likewise the gods who hearken unto the word [of truth], the Khepriu      
gods who are in the following of Osiris. Hold ye your peace then, O ye      
gods, whilst the God holdeth speech with me, he who listeneth to the        
truth. I speak unto him my words. Osiris, grant thou that that which        
cometh forth from thy mouth may circulate to me. Let me see thine           
own Form. Let thy Souls envelop me. Grant thou that I may come              
forth, and that I may be master of my legs, and let me live there like      
Nebertcher upon his throne. Let the gods of the Tuat hold me in             
fear, and let them fight for me in their halls. Grant thou that I           
may move forward with him and with the Ariu gods, and let me be firmly      
stablished on my pedestal like the Lord of Life. Let me be in the           
company of Isis, the goddess, and let [the gods] keep me safe from him      
that would do an injury unto me. Let none come to see the helpless          
one. May I advance, and may I come to the Henti boundaries of the sky.      
Let me address words to Keb, and let me make supplicaion to the god Hu      
with Nebertcher. Let the gods of the Tuat be afraid of me, and let          
them fight for me in their halls. Let them see that thou hast provided      
me with food for the festival. I am one of those Spirit-souls who           
dwell in the Light-god. I have made my form in his Form, when he            
cometh to Tetu. I am a Spirit-body among his Spirit-bodies; he shall        
speak unto thee the things [which concern] me. Would that he would          
cause me to be held in fear! Would that he would create [in them]           
awe of me! Let the gods of the Tuat be afraid of me, and let them           
fight for me [in their halls]. I, even I, am a Spirit-soul, a               
dweller in the Light-god, whose form hath been created in divine            
flesh. I am one of those Spirit-souls who dwell in the Light-god,           
who were created by Tem himself, and who exist in the blossoms of           
his Eye. He hath made to exist, he hath made glorious, and he hath          
magnified their faces during their existence with him. Behold, he is        
Alone in Nu. They acclaim him when he cometh forth from the horizon,        
and the gods and the Spirit-souls who have come into being with him         
ascribe fear unto him.                                                      
  I am one of the worms which have been created by the Eye of the Lord      
One. And behold, when as yet Isis had not given birth to Horus, I           
was flourishing, and I had waxed old, and had become pre-eminent among      
the Spirit-souls who had come into being with him. I rose up like a         
divine hawk, and Horus endowed me with a Spirit-body with his soul, so      
that [I] might take possession of the property of Osiris in the             
Tuat. He shall say to the twin Lion-gods for me, the Chief of the           
House of the Nemes Crown, the Dweller in his cavern: Get thee back          
to the heights of heaven, for behold, inasmuch as thou art a                
Spirit-body with the creations of Horus, the Nemes Crown shall not          
be to thee: [but] thou shalt have speech even to the uttermost              
limits of the heavens. I, the warder, took possession of the                
property of Horus [which belonged] to Osiris in the Tuat, and Horus         
repeated to me what his father Osiris had said unto him in the years        
[past], on the days of his burial. Give thou to me the Nemes Crown,         
say the twin Lion-gods for me. Advance thou, come along the road of         
heaven, and look upon those who dwell in the uttermost limits of the        
horizon. The gods of the Tuat shall hold thee in fear, and they             
shall fight for thee in their halls. The god Auhet belongeth to             
them. All the gods who guard the shrine of the Lord One are smitten         
with terror at [my] words.                                                  
  Hail, saith the god who is exalted upon his coffer to me! He hath         
bound on the Nemes Crown, [by] the decree of the twin Lion-gods. The        
god Aahet hath made a way for me. I am exalted [on the coffer], the         
twin Lion-gods have bound the Nemes Crown on me and my two locks of         
hair are given unto me. He hath stablished for me my heart by his           
own flesh, and by his great, two-fold strength, and I shall not fall        
headlong before Shu. I am Hetep, the Lord of the two Uraei-goddesses        
who are to be adored. I know the Light-god, his winds are in my             
body. The Bull which striketh terror [into souls] shall not repulse         
me. I come daily into the House of the twin Lion-gods. I come forth         
therefrom into the House of Isis. I look upon the holy things which         
are hidden. I see the being who is therein. I speak to the great            
ones of Shu, they repulse him that is wrathful in his hour. I am Horus      
who dwelleth in his divine Light. I am master of his crown. I am            
master of his radiance. I advance towards the Henti boundaries of           
heaven. Horus is upon his seat. Horus is upon his thrones. My face          
is like that of a divine hawk. I am one who is equipped [like] his          
lord. I shall come forth to Tetu. I shall see Osiris. I shall live          
in his actual presence.... Nut. They shall see me. I shall see the          
gods [and] the Eye of Horus burning with fire before my eyes. They          
shall reach out their hands to me. I shall stand up. I shall be master      
of him that would subject me to restraint. They shall open the holy         
paths to me, they shall see my form, they shall listen to my words.         
  [Homage] to you, O ye gods of the Tuat, whose faces are turned back,      
whose powers advance, conduct ye me to the Star-gods which never rest.      
Prepare ye for me the holy ways to the Hemat house, and to your god,        
the Soul, who is the mighty one of terror. Horus hath commanded me          
to lift up your faces; do ye look upon me. I have risen up like a           
divine hawk. Horus hath made me to be a Spirit-body by means of his         
Soul, and to take possession of the things of Osiris in the Tuat. Make      
ye for me a path. I have travelled and I have arrived at those who are      
chiefs of their caverns, and who are guardians of the House of Osiris.      
I speak unto them his mighty deeds. I made them to know concerning his      
victories. He is ready [to butt with his] two horns at Set. They            
know him who hath taken possession of the god Hu, and who hath taken        
possession of the Powers of Tem.                                            
  Travel thou on thy way safely, cry out the gods of the Tuat to me. O      
ye who make your names pre-eminent, who are chiefs in your shrines,         
and who are guardians of the House of Osiris, grant, I pray you,            
that I may come to you. I have bound up and I have gathered together        
your Powers. I have directed the Powers of the ways, the wardens of         
the horizon, and of the Hemat House of heaven. I have stablished their      
fortresses for Osiris. I have prepared the ways for him. I have             
performed the things which [he] hath commanded. I come forth to             
Tetu. I see Osiris. I speak to him concerning the matter of his             
Great Son, whom he loveth, and concerning [the smiting of] the heart        
of Set. I look upon the lord who was helpless. How shall I make them        
to know the plans of the gods, and that which Horus did without the         
knowledge of his father Osiris?                                             
  Hail, Lord, thou Soul, most awful and terrible, behold me. I have         
come, I make thee to be exalted! I have forced a way though the             
Tuat. I have opened the roads which appertain to heaven, and those          
which appertain to the earth, and no one hath opposed me therein. I         
have exalted thy face, O Lord of Eternity.                                  
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (In the Papyrus of Nu, Sheet 14, the Chapter ends with the                
following.)                                                                 
-                                                                           
  Exalted art thou on thy throne, O Osiris! Thou hast heard fair            
things, O Osiris! Thy strength is vigorous, O Osiris! Thy head is           
fastened on thy body, O Osiris! Thy neck is made firm, O Osiris! Thy        
heart is glad, [O Osiris!]. Thy speech is made effective, O Osiris!         
Thy princes rejoice Thou art established the Bull in Amentet. Thy           
son Horus hath ascended thy trrone, and all life is with him. Millions      
of years minister unto him, and millions of years hold him in fear.         
The Company of the Gods are his servants, and they fold him in fear.        
The god Tem, the Governor, the only One among the gods, hath spoken,        
and his word passeth not away. Horus is both the divine food and the        
sacrifice. He made haste to gather together [the members of] of his         
father. Horus is his deliverer. Horus is his deliverer. Horus hath          
sprung from the essence of his divine father and from his decay. He         
hath become the Governor of Egypt. The gods shall work for him, and         
they shall toil for him for million of years. He shall make millions        
of years to live through his Eye, the only one of its lord,                 
Nebertcher.]                                                                
-                                                                           
  (From the Turin Papyrus, Bl. XXX)                                         
-                                                                           
                                                     {APPENDIX ^paragraph 5}
  Exalted is thy throne, O Osiris. Thou hearest well, O Osiris. Thy         
strength flourisheth, O Osiris. I have fastened thy head [on thy] body      
for thee. I have stablished thy throat, the throne of the joy of thy        
heart. Thy words are stable. Thy shenit princes are glad. Thou art          
stablished as the Bull of Amentet. Thy son Horus hath ascended thy          
throne. All life is with him. Millions of years work for him. The           
Company of the Gods fear him. Tem, the One Power of the Gods, hath          
spoken, and what he hath said is not changed, Hetu Aabi. Horus hath         
stood up. I have gone about collecting his father. Horus hath               
delivered his father. Horus hath delivered [his mother]. My mother          
is Horus. My brother is Horus. My uncle is Horus. I have come. Horus        
followeth his father.... there the dirt of his head. The gods shall         
serve him. Millions of years...... in his Eye, the Only One of its          
Lord, Neb-er-tcher.                                                         
                                                                            
CHANGING_INTO_THE_PRINCE_OF_TCHATCHAU_CHIEFS                                
-                                                                           
  THE CHAPTER OF BEING TRANSFORMED INTO THE PRINCE OF THE TCHATCHAU         
CHIEFS. The Osiris Nu, whose word is truth, saith:- I am the god            
Tem, the maker of the sky, the creator of the things which are, who         
cometh forth from the earth, who made the seed of man to come into          
being, the Lord of things, who fashioned the gods, the Great God,           
who created himself, the Lord of Life, who made to flourish the Two         
Companies of the Gods. Homage to you, O ye divine Lords of things,          
ye holy beings, whose seats are veiled! Homage to you, O ye Lords of        
Eternity, whose forms are concealed, whose sanctuaries are                  
mysteries, whose places of abode are not known! Homage to you, O ye         
gods, who dwell in the Tenait (Circle of Light)! Homage to you, O ye        
gods of the Circle of the country of the Cataracts! Homage to you, O        
ye gods who dwell in Amentet! Homage to you, O ye gods who dwell            
within Nut! Grant ye to me that I may come before you, I am pure, I am      
like a god. I am endowed with a Spirit-soul. I am strong. I am endowed      
with a Heart-soul. I bring unto you incense, and spice, and natron.         
I have done away with the chidings of your mouths. I have come, I have      
done away the evil which was in your hearts, and I have removed the         
offences which appertained to you [against me]. I bring to you deeds        
of well-doing, and I present before you truth. I know you. I know your      
names. I know your forms which are not known. I come into being             
among you. My coming is like unto that god who eateth men, and who          
feedeth upon the gods. I am strong before you even like that god who        
is exalted upon his pedestal, unto whom the gods come with                  
rejoicing, and the goddesses make supplication when they see me. I          
have come unto you. I have ascended my throne like your Two Daughters.      
I have taken my seat in the horizon. I receive my offerings of              
propitiation upon my altars. I drink my fill of seth wine every             
evening. I come to those who are making rejoicings, and the gods who        
live in the horizon ascribe unto me praises, as the divine                  
Spirit-body, the Lord of mortals. I am exalted like that holy god           
who dwelleth in the Great House. The gods rejoice greatly when they         
see my beautiful appearances from the body of the goddess Nut, and          
when the goddess Nut bringeth me forth.                                     
                                                                            
CHANGING_INTO_THE_SERPENT_SATA                                              
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO THE SERPENT SATA.         
The Osiris Ani, whose word is truth, saith:- I am the serpent Sata          
whose years are infinite. I lie down dead. I am born daily. I am the        
serpent Sa-en-ta, the dweller in the uttermost parts of the earth. I        
lie down in death. I am born, I become new, I renew my youth every          
day.                                                                        
                                                                            
CHANGING_INTO_THE_CROCODILE_GOD                                             
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO THE CROCODILE-GOD.        
The Osiris Ani, whose word is truth, saith:- I am the Crocodile-god         
(Sebak) who dwelleth amid his terrors. I am the Crocodile-god and I         
seize [my prey] like a ravening beast. I am the great Fish which is in      
Kamui. I am the Lord to whom bowings and prostrations are made in           
Sekhem. And the Osiris Ani is the lord to whom bowings and                  
prostrations are made in Sekhem.                                            
-                                                                           
-                                                                           
  (From the Papyrus of Nebseni)                                             
-                                                                           
  Behold, I am the dweller in his terrors, I am the crocodile, his          
firstborn. I bring (prey) from a distance. I am the Fish of Horus, the      
Great One in Kamui. I am the lord of bowings in Sekhem.                     
                                                                            
CHANGING_INTO_PTAH                                                          
-                                                                           
  THE CHAPTER OF MAKING THE TRANSFORMATION INTO PTAH. The Osiris Ani        
[whose word is truth, saith]:- I eat bread. I drink ale. I gird up          
my garments. I fly like a hawk. I cackle like the Smen goose. I alight      
upon that place hard by the Sepulchre on the festival of the Great          
God. That which is abominable, that which is abominable I will not          
eat. [An abominable thing] is filth, I will not eat thereof. That           
which is an abomination unto my KA shall not enter my body. I will          
live upon that whereon live the gods and the Spirit-souls. I shall          
live, and I shall be master of their cakes. I am master of them, and I      
shall eat them under the trees of the dweller in the House of               
Hathor, my Lady. I will make an offering. My cakes are in Tetu, my          
offerings are in Anu. I gird about myself the robe which is woven           
for me by the goddess Tait. I shall stand up and sit down in                
whatsoever place it pleaseth me to do so. My head is like unto that of      
Ra. I am gathered together like Tem.                                        
  Here offer the four cakes of Ra, and the offerings of the earth.          
  I shall come forth. My tongue is like that of Ptah, and my throat is      
like unto that of Hathor, and I remember the words of Tem, of my            
father, with my mouth. He forced the woman, the wife of Keb,                
breaking the heads near him; therefore was the fear of him there.           
[His] praises are repeated with vigour. I am decreed to be the Heir,        
the lord of the earth of Keb. I have union with women. Keb hath             
refreshed me, and he hath caused me to ascend his throne. Those who         
dwell in Anu bow their heads to me. I am [their] Bull, I am stronger        
than [the Lord] of the hour. I unite with women. I am master for            
millions of years.                                                          
                                                                            
TURNING_INTO_THE_SOUL_OF_TEM                                                
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO THE SOUL OF TEM. The      
Osiris Ani, whose word is truth, saith:- I shall not enter into the         
place of destruction, I shall not perish, I shall not know [decay].         
I am Ra, who came forth from Nu, the Soul of the God who created his        
own members. What I abominate is sin; I will not look thereon. I cry        
not out against truth, nay, I live therein. I am the god Hu, the            
imperishable god, in my name of "Soul." I have created myself with Nu,      
in the name of "Khepera." I exist in them like Ra. I am the Lord of         
Light.                                                                      
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu)                                                  
-                                                                           
  That which is an abomination unto me is death; let me not go into         
the chamber of torture which is in the Tuat. I am the delight of the        
Khu of Osiris. I make to be content the heart[s] of those who dwell         
among the divine things which are beloved [by me]. They cause the fear      
of me [to abound], they create the awe of me to be in those divine          
beings who dwell in their own circles. Behold, I am exalted on my           
own standard, and upon my throne, and upon my seat which is assigned        
[to me]. I am the god Nu, and those who commit sin shall not destroy        
me. I am the firstborn of the primeval god, and my soul is the Souls        
of the Eternal Gods, and my body is Everlastingness. My created form        
is [that of] the god Eternity, the Lord of Years, and the Prince of         
Everlastingness. I am the Creator of the Darkness, who maketh his seat      
in the uttermost limits of the heavens, [which] I love. I arrive at         
their boundaries. I advance upon my two legs. I direct my resting           
place. I sail over the sky. I fetter and destroy the hidden serpents        
which are about my footsteps [in going to] the Lord of the Two Arms.        
My soul is the Souls of the Eternal Gods, and my body is                    
Everlastingness. I am the exalted one, the Lord of the Land of Tebu. I      
am the Child in the city: "Young man in the country" is my name.            
"Imperishable one" is my name. I am the Soul Creator of Nu. I make          
my habitation in Khert-Neter. My nest is invisible, my egg is not           
broken. I have done away the evil which is in me. I shall see my            
Father, the Lord of the Evening. His body dwelleth in Anu. I am made        
to be the Light-god, a dweller in the Light-god, over the Western           
Domain of the Hebt bird.                                                    
                                                                            
CHANGING_INTO_THE_BENU_BIRD                                                 
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO THE BENU BIRD. The        
Osiris, the scribe Ani, whose word is truth, saith:- I flew up out          
of primeval matter. I came into being like the god Khepera. I               
germinated like the plants. I am concealed like the tortoise [in his        
shell]. I am the seed of every god. I am Yesterday of the Four              
[Quarters of the Earth, and] the Seven Uraei, who came into being in        
the Eastern land. [I am] the Great One (Horus) who illumineth the           
Hememet spirits with the light of his body. [I am] that god in respect      
of Set. [I am] Thoth who [stood] between them (Horus and Set) as the        
judge on behalf of the Governor of Sekhem and the Souls of Anu. [He         
was like] a stream between them. I have come. I rise up on my               
throne. I am endowed with Khu. I am mighty. I am endowed with               
godhood among the gods. I am Khensu, [the lord] of every kind of            
strength.                                                                   
-                                                                           
  RUBRIC: [If] this Chapter [be known by the deceased], he shall            
come forth pure by day after his death, and he shall perform every          
transformation which his soul desireth to make. He shall be among the       
Followers of Un-Nefer, and he shall satisfy himself with the food of        
Osiris, and with sepulchral meals. He shall see the Disk [of the Sun],      
he shall be in good case upon earth before Ra, and his word shall be        
truth in the sight of Osiris, and no evil thing whatsoever shall            
have dominion over him for ever and ever.                                   
                                                                            
CHANGING_INTO_A_HERON                                                       
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO A HERON. The              
Osiris the scribe Ani, whose word is truth, saith:- I am the master of      
beasts brought for sacrifice, [and] of the knives which are [held]          
at their heads [and] their beards; those who dwell in their emerald         
[fields], the Aged Gods, and the Spirit-souls, are ready at the moment      
for the Osiris Ani, whose word is truth, in peace. He maketh slaughter      
on the earth, and I make slaughter on the earth. I am strong. I follow      
the heights unto heaven. I have made myself pure. I walk with long          
strides to my city. I have become an owner of land there. I advance to      
Sepu...... is given to me in Unu. I have set the gods upon their            
roads. I have made splendid the houses and towns of those who are in        
their shrines. I know the stream of Nut. I know Tatun. I know Teshert.      
I have brought along their horns. I know Heka. I have hearkened to          
this words. I am the Red Bull-calf which is marked with markings.           
The gods shall say when they hear [of me]: Uncover your faces. His          
coming is to me. There is light which ye know not. Times and seasons        
are in my body. I do not speak [lies] in the place of truth, daily.         
The truth is hidden on the eyebrows. [By] night [I] sail up the             
river to keep the feast of him that is dead, to embrace the Aged            
God, and to guard the earth, I the Osiris Ani, whose word is truth.         
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Saite Recension)                                                
-                                                                           
  RUBRIC: If this Chapter be known [by the deceased], he will live          
like a perfect Spirit-soul in Khert-Neter; no evil thing whatsoever         
shall overthrow him.                                                        
                                                                            
CHANGING_INTO_A_LOTUS                                                       
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO THE LOTUS. The            
Osiris Ani, whose word is truth, saith:- I am the holy lotus that           
cometh forth from the light which belongeth to the nostrils of Ra, and      
which belongeth to the head of Hathor. I have made my way, and I            
seek after him, that is to say, Horus. I am the pure lotus that cometh      
forth from the field [of Ra].                                               
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (Naville, op. cit., I, Bl. XCIII)                                         
-                                                                           
  Chapter of making the transformation into a lotus. The Osiris, the        
lady of of the house, Aui, whose word is truth, in peace, saith:-           
Hail, thou Lotus, thou type of the god Nefer-Temu! I am the man who         
knoweth your names. I know your names among the gods, the lords of          
Khert-Neter. I am one among you. Grant ye that I may see the gods           
who are the Guides of the Tuat. Grant ye to me a seat in                    
Khert-Neter, near the Lords of Amentet. Assign to me a habitation in        
the land of Tchesert. Receive ye me in the presence of the Lords of         
Eternity. Let my soul come forth in whatsoever place it pleaseth.           
Let it not be rejected in the presence of the Great Company of the          
Gods.                                                                       
                                                                            
TURNING_INTO_THE_GOD_WHO_LIGHTENETH_DARKNESS                                
-                                                                           
  [THE CHAPTER OF] MAKING THE TRANSFORMATION INTO THE GOD WHO               
LIGHTENETH THE DARKNESS. The Osiris the scribe Ani, whose word is           
truth, saith:- I am the girdle of the garment of the god Nu, which          
giveth light, and shineth, and belongeth to his breast, the                 
illuminer of the darkness, the uniter of the two Rehti deities, the         
dweller in my body, through the great spell of the words of my              
mouth. I rise up, but he who was coming after me hath fallen. He who        
was with him in the Valley of Abtu hath fallen. I rest. I remember          
him. The god Hu hath taken possession of me in my town. I found him         
there. I have carried away the darkness by my strength, I have              
filled the Eye [of Ra] when it was helpless, and when it came not on        
the festival of the fifteenth day. I have weighed Sut in the celestial      
houses against the Aged One who was with him. I have equipped Thoth in      
the House of the Moon-god, when the fifteenth day of the festival come      
not. I have taken possession of the Urrt Crown. Truth is in my body;        
turquoise and crystal are its months. My homestead is there among           
the lapis-lazuli, among the furrows thereof. I am Hem-Nu, the               
lightener of the darkness. I have come to lighten the darkness; it          
is light. I have lightened the darkness. I have overthrown the              
ashmiu-fiends. I have sung hymns to those who dwell in the darkness. I      
have made to stand up the weeping ones, whose faces were covered over;      
they were in a helpless state of misery. Look ye then upon me. I am         
Hem-Nu. I will not let you hear concerning it. [I have fought. I am         
Hem-Nu. I have lightened the darkness. I have come. I have made an end      
to the darkness which hath become light indeed.]                            
                                                                            
NOT_DYING_A_SECOND_TIME                                                     
-                                                                           
  THE CHAPTER OF NOT DYING A SECOND TIME. The Osiris Ani, whose word        
is truth, saith:- Hail, Thoth! What is it that hath happened to the         
children of Nut? They have waged war, they have upheld strife, they         
have done evil, they have created the fiends, they have made                
slaughter, they have caused trouble; in truth, in all their doings the      
strong have worked against the weak. Grant, O might of Thoth, that          
that which the god Tem hath decreed [may be done!] And thou                 
regardest not evil, nor art thou provoked to anger when they bring          
their years to confusion, and throng in and push in to disturb their        
months. For in all that they have done unto thee they have worked           
iniquity in secret. I am they writing-palette, O Thoth, and I have          
brought unto thee thine ink-jar. I am not of those who work iniquity        
in their secret places; let not evil happen unto me.                        
  The Osiris, the scribe Ani, whose word is truth, saith:- Hail, Temu!      
What manner of land is this unto which I have come? It hath not water,      
it hath not air; it is depth unfathomable, it is black as the blackest      
night, and men wander helplessly therein. In it a man cannot live in        
quietness of heart; nor may the longings of love be satisfied therein.      
But let the state of the Spirit-souls be given unto me instead of           
water and air, and the satisfying of the longings of love, and let          
quietness of heart be given unto me instead of cakes and ale. The           
god Tem hath decreed that I shall see thy face, and that I shall not        
suffer from the things which pain thee. May every god transmit unto         
thee his throne for millions of years. Thy throne hath descended            
unto thy son Horus, and the god Tem hath decreed that thy course shall      
be among the holy princes. In truth he shall rule from thy throne, and      
he shall be heir to the throne of the Dweller in the fiery Lake             
[Neserser]. In truth it hath been decreed that in me he shall see           
his likeness, and that my face shall look upon the face of the Lord         
Tem. How long then have I to live? It is decreed that thou shalt            
live for millions of years, a life of millions of years. Let it be          
granted to me to pass on to the holy princes, for indeed, I have            
done away all the evil which I committed, from the time when this           
earth came into being from Nu, when it sprang from the watery abyss         
even as it was in the days of old. I am Fate and Osiris, I have made        
my transformations into the likeness of divers serpents. Man knoweth        
not, and the gods cannot behold the two-fold beauty which I have            
made for Osiris, the greatest of the gods. I have given unto him the        
region of the dead. And, verily, his son Horus is seated upon the           
throne of the Dweller in the fiery Lake [of Neserser], as his heir.         
I have made him to have his throne in the Boat of Millions of Years.        
Horus is stablished upon his throne [among his] kinsmen, and he hath        
all that is with him. Verily, the Soul of Set, which is greater than        
all the gods, hath departed. Let it be granted to me to bind his            
soul in fetter in the Boat of the God, when I please, and let him hold      
the Body of the God in fear. O my father Osiris, thou hast done for me      
that which thy father Ra did for thee. Let me abide upon the earth          
permanently. Let me keep possession of my throne. Let my heir be            
strong. Let my tomb, and my friends who are upon the earth,                 
flourish. Let my enemies be given over to destruction, and to the           
shackles of the goddess Serq. I am thy son. Ra is my father. On me          
likewise thou hast conferred life, strength, and health. Horus is           
established upon his tomb. Grant thou that the days of my life may          
come unto worship and honour.                                               
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Leyden Papyrus of Ra)                                           
-                                                                           
  RUBRIC: This Chapter shall be recited over a figure of Horus, made        
of lapis-lazuli, which shall be placed on the neck of the deceased. It      
is a protection upon earth, and it will secure for the deceased the         
affection of men, gods, and the Spirit-souls which are perfect.             
Moreover it acteth as a spell in Khert-Neter, but it must be recited        
by thee on behalf of the Osiris Ra, regularly and continually millions      
of times.                                                                   
                                                                            
ENTERING_THE_HALL_OF_MAAT                                                   
-                                                                           
  [THE CHAPTER OF] ENTERING INTO THE HALL OF MAATI TO PRAISE OSIRIS         
KHENTI-AMENTI. The Osiris the scribe Ani, whose word is truth, saith:-      
I have come unto thee. I have drawn nigh to behold thy beauties (thy        
beneficient goodness). My hands are [extended] in adoration of thy          
name of "Maat." I have come. I have drawn nigh unto [the place              
where] the cedar-tree existeth not, where the acacia tree doth not put      
forth shoots, and where the ground produceth neither grass nor              
herbs. Now I have entered into the habitation which is hidden, and I        
hold converse with Set. My protector advanced to me, covered was his        
face.... on the hidden things. He entered into the house of Osiris, he      
saw the hidden things which were therein. The Tchatchau Chiefs of           
the Pylons were in the form of Spirits. The god Anpu spake unto             
those about him with the words of a man who cometh from Ta-mera,            
saying, "He knoweth our roads and our towns. I am reconciled unto him.      
When I smell his odour it is even as the odour of one of you." And I        
say unto him: I the Osiris Ani, whose word is truth, in peace, whose        
word is truth, have come. I have drawn nigh to behold the Great             
Gods. I would live upon the propitiatory offerings [made] to their          
Doubles. I would live on the borders [of the territory of] the Soul,        
the Lord of Tetu. He shall make me to come forth in the form of a Benu      
bird, and to hold converse [with him.] I have been in the stream [to        
purify myself]. I have made offerings of incense. I betook myself to        
the Acacia Tree of the [divine] Children. I lived in Abu in the             
House of the goddess Satet. I made to sink in the water the boat of         
the enemies. I sailed over the lake [in the temple] in the Neshmet          
Boat. I have looked upon the Sahu of Kamur. I have been in Tetu. I          
have held my peace. I have made the god to be master of his legs. I         
have been in the House of Teptuf. I have seen him, that is the              
Governor of the Hall of the God. I have entered into the House of           
Osiris and I have removed the head-coverings of him that is therein. I      
have entered into Rasta, and I have seen the Hidden One who is              
therein. I was hidden, but I found the boundary. I journeyed to             
Nerutef, and he who was therein covered me with a garment. I have           
myrrh of women, together with the shenu powder of living folk.              
Verily he (Osiris) told me the things which concerned himself. I said:      
Let thy weighing of me be even as we desire.                                
  And the Majesty of Anpu shall say unto me, "Knowest thou the name of      
this door, and canst thou tell it?" And the Osiris the scribe Ani,          
whose word is truth, in peace, whose word is truth, shall say,              
"Khersek-Shu" is the name of this door. And the Majesty of the god          
Anpu shall say unto me, "Knowest thou the name of the upper leaf,           
and the name of the lower leaf?" [And the Osiris the scribe Ani] shall      
say: "Neb-Maat-heri-retiu-f" is the name of the upper leaf and              
"Neb-pehti-thesu-menment" [is the name of the lower leaf. And the           
Majesty of the god Anpu shall say], "Pass on, for thou hast knowledge,      
O Osiris the scribe, the assessor of the holy offerings of all the          
gods of Thebes Ani, whose word is truth, the lord of loyal service [to      
Osiris]."                                                                   
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu, Brit. Mus. No. 10477, Sheet 22)                  
-                                                                           
  [THE FOLLOWING] WORDS SHALL BE SAID BY THE STEWARD OF THE KEEPER          
OF THE SEAL, NU, WHOSE WORD IS TRUTH, WHEN HE COMETH FORTH TO THE HALL      
OF MAATI, SO THAT HE MAY BE SEPARATED FROM EVERY SIN WHICH HE HATH          
COMMITTED, AND MAY BEHOLD THE FACES OF THE GODS. The Osiris Nu,             
whose word is truth, saith: Homage to thee, O great God, Lord of            
Maati! I have come unto thee, O my Lord, and I have brought myself          
hither that I may behold thy beauties. I know thee, I know thy name, I      
know the names of the Forty-two Gods who live with thee in this Hall        
of Maati, who live by keeping ward over sinners, and who feed upon          
their blood on the day when the consciences of men are reckoned up          
in the presence of the god Un-Nefer. In truth thy name is                   
"Rehti-Merti-Nebti-Maati." In truth I have come unto thee, I have           
brought Maati (Truth) to thee. I have done away sin for thee. I have        
not committed sins against men. I have not opposed my family and            
kinsfolk. I have not acted fraudulently in the Seat of Truth. I have        
not known men who were of no account. I have not wrought evil. I            
have not made it to be the first [consideration daily that                  
unnecessary] work should be done for me. I have not brought forward my      
name for dignities. I have not [attempted] to direct servants [I            
have not belittled God]. I have not defrauded the humble man of his         
property. I have not done what the gods abominate. I have not vilified      
a slave to his master. I have not inflicted pain. I have not caused         
anyone to go hungry. I have not made any man to weep. I have not            
committed murder. I have not given the order for murder to be               
committed. I have not caused calamities to befall men and women. I          
have not plundered the offerings in the temples. I have not                 
defrauded the gods of their cake-offerings. I have not carried off the      
fenkhu cakes [offered to] the Spirits. I have not committed                 
fornication. I have not masturbated [in the sanctuaries of the god          
of my city]. I have not diminished from the bushel. I have not filched      
[land from my neighbour's estate and] added it to my own acre. I            
have not encroached upon the fields [of others]. I have not added to        
the weights of the scales. I have not depressed the pointer of the          
balance. I have not carried away the milk from the mouths of children.      
I have not driven the cattle away from their pastures. I have not           
snared the geese in the goose-pens of the gods. I have not caught fish      
with bait made of the bodies of the same kind of fish. I have not           
stopped water when it should flow. I have not made a cutting in a           
canal of running water. I have not extinguished a fire when it              
should burn. I have not violated the times [of offering] the chosen         
meat offerings. I have not driven away the cattle on the estates of         
the gods. I have not turned back the god at his appearances. I am           
pure. I am pure. I am pure. My pure offerings are the pure offerings        
of that great Benu which dwelleth in Hensu. For behold, I am the            
nose of Neb-nefu (the lord of the air), who giveth sustenance unto all      
mankind, on the day of the filling of the Utchat in Anu, in the second      
month of the season Pert, on the last of the month, [in the presence        
of the Lord of this earth]. I have seen the filling of the Utchat in        
Anu, therefore let not calamity befall me in this land, or in this          
Hall of Maati, because I know the names of the gods who are therein,        
[and who are the followers of the Great God].                               
                                                                            
THE_NEGATIVE_CONFESSION                                                     
  THE NEGATIVE CONFESSION                                                   
-                                                                           
  Hail, Usekh-nemmt, who comest forth from Anu, I have not committed        
sin.                                                                        
  Hail, Hept-khet, who comest forth from Kher-aha, I have not               
committed robbery with violence.                                            
  Hail, Fenti, who comest forth from Khemenu, I have not stolen.            
  Hail, Am-khaibit, who comest forth from Qernet, I have not slain men      
and women.                                                                  
  Hail, Neha-her, who comest forth from Rasta, I have not stolen            
grain.                                                                      
                                      {THE_NEGATIVE_CONFESSION ^paragraph 5}
  Hail, Ruruti, who comest forth from heaven, I have not purloined          
offerings.                                                                  
  Hail, Arfi-em-khet, who comest forth from Suat, I have not stolen         
the property of God.                                                        
  Hail, Neba, who comest and goest, I have not uttered lies.                
  Hail, Set-qesu, who comest forth from Hensu, I have not carried away      
food.                                                                       
  Hail, Utu-nesert, who comest forth from Het-ka-Ptah, I have not           
uttered curses.                                                             
                                     {THE_NEGATIVE_CONFESSION ^paragraph 10}
  Hail, Qerrti, who comest forth from Amentet, I have not committed         
adultery, I have not lain with men.                                         
  Hail, Her-f-ha-f, who comest forth from thy cavern, I have made none      
to weep.                                                                    
  Hail, Basti, who comest forth from Bast, I have not eaten the heart.      
  Hail, Ta-retiu, who comest forth from the night, I have not attacked      
any man.                                                                    
  Hail, Unem-snef, who comest forth from the execution chamber, I am        
not a man of deceit.                                                        
                                     {THE_NEGATIVE_CONFESSION ^paragraph 15}
  Hail, Unem-besek, who comest forth from Mabit, I have not stolen          
cultivated land.                                                            
  Hail, Neb-Maat, who comest forth from Maati, I have not been an           
eavesdropper.                                                               
  Hail, Tenemiu, who comest forth from Bast, I have not slandered           
[no man].                                                                   
  Hail, Sertiu, who comest forth from Anu, I have not been angry            
without just cause.                                                         
  Hail, Tutu, who comest forth from Ati (the Busirite Nome), I have         
not debauched the wife of any man.                                          
                                     {THE_NEGATIVE_CONFESSION ^paragraph 20}
  Hail, Uamenti, who comest forth from the Khebt chamber, I have not        
debauched the wife of [any] man.                                            
  Hail, Maa-antuf, who comest forth from Per-Menu, I have not polluted      
myself.                                                                     
  Hail, Her-uru, who comest forth from Nehatu, I have terrorized none.      
  Hail, Khemiu, who comest forth from Kaui, I have not transgressed         
[the law].                                                                  
  Hail, Shet-kheru, who comest forth from Urit, I have not been wroth.      
                                     {THE_NEGATIVE_CONFESSION ^paragraph 25}
  Hail, Nekhenu, who comest forth from Heqat, I have not shut my            
ears to the words of truth.                                                 
  Hail, Kenemti, who comest forth from Kenmet, I have not blasphemed.       
  Hail, An-hetep-f, who comest forth from Sau, I am not a man of            
violence.                                                                   
  Hail, Sera-kheru, who comest forth from Unaset, I have not been a         
stirrer up of strife.                                                       
  Hail, Neb-heru, who comest forth from Netchfet, I have not acted          
with undue haste.                                                           
                                     {THE_NEGATIVE_CONFESSION ^paragraph 30}
  Hail, Sekhriu, who comest forth from Uten, I have not pried into          
matters.                                                                    
  Hail, Neb-abui, who comest forth from Sauti, I have not multiplied        
my words in speaking.                                                       
  Hail, Nefer-Tem, who comest forth from Het-ka-Ptah, I have wronged        
none, I have done no evil.                                                  
  Hail, Tem-Sepu, who comest forth from Tetu, I have not worked             
witchcraft against the king.                                                
  Hail, Ari-em-ab-f, who comest forth from Tebu, I have never               
stopped [the flow of] water.                                                
                                     {THE_NEGATIVE_CONFESSION ^paragraph 35}
  Hail, Ahi, who comest forth from Nu, I have never raised my voice.        
  Hail, Uatch-rekhit, who comest forth from Sau, I have not cursed          
God.                                                                        
  Hail, Neheb-ka, who comest forth from thy cavern, I have not acted        
with arrogance.                                                             
  Hail, Neheb-nefert, who comest forth from thy cavern, I have not          
stolen the bread of the gods.                                               
  Hail, Tcheser-tep, who comest forth from the shrine, I have not           
carried away the khenfu cakes from the Spirits of the dead.                 
                                     {THE_NEGATIVE_CONFESSION ^paragraph 40}
  Hail, An-af, who comest forth from Maati, I have not snatched away        
the bread of the child, nor treated with contempt the god of my city.       
  Hail, Hetch-abhu, who comest forth from Ta-she (the Fayyum), I            
have not slain the cattle belonging to the god.                             
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nebseni)                                             
-                                                                           
  Hail, Usekh-nemmt, who comest forth from Anu, I have not committed        
sin.                                                                        
  Hail, Hept-Shet, who comest forth from Kher-aha, I have not robbed        
with violence.                                                              
  Hail, Fenti, who comest forth from Khemenu, I have done no violence.      
  Hail, Am-khaibitu, who comest forth from Qerrt, I have not stolen.        
                                                     {APPENDIX ^paragraph 5}
  Hail, Neha-hau, who comest forth from Rasta, I have not slain men.        
  Hail, Ruruti, who comest forth from heaven, I have not made light         
the bushel.                                                                 
  Hail, Arti-f-em-tes, who comest forth from Sekhem, I have not             
acted deceitfully.                                                          
  Hail, Neba, who comest and goest, I have not stolen the property          
of the god.                                                                 
  Hail, Set-qesu, who comest forth from Hensu, I have not told lies.        
                                                    {APPENDIX ^paragraph 10}
  Hail, Uatch-nesert, who comest forth from Het-ka-Ptah, I have not         
carried away food.                                                          
  Hail, Qerti, who comest forth from Amenti, I have not uttered evil        
words.                                                                      
  Hail, Hetch-abhu, who comest from Ta-she, I have attacked no man.         
  Hail, Unem-snef, who comest forth from the execution chamber, I have      
not salin a bull which was the property of the god.                         
  Hail, Unem-besku, who comest [forth from the Mabet chamber], I            
have not acted deceitfully.                                                 
                                                    {APPENDIX ^paragraph 15}
  Hail, Neb-maat, who comest forth from Maati, I have not pillaged the      
lands which have been ploughed.                                             
  Hail, Thenemi, who comest forth from Bast, I have never pried into        
matters [to make mischief].                                                 
  Hail, Aati, who comest forth from Anu, I have not set my mouth in         
motion.                                                                     
  Hail, Tutuf, who comest from from A, I have not been wroth except         
with reason.                                                                
  Hail, Uamemti, who comest forth from the execution chamber, I have        
not debauched the wife of a man.                                            
                                                    {APPENDIX ^paragraph 20}
  Hail, Maa-anuf, who comest forth from Per-Menu, I ahve not                
polluted myself.                                                            
  Hail, Heri-uru, who comest forth from [Nehatu], I have terrorized no      
man.                                                                        
  Hail, Khemi, who comest forth from Ahaui, I have not made attacks.        
  Hail, Shet-kheru, who comest forth from Uri, I have not been a man        
of anger.                                                                   
  Hail, Nekhem, who comest forth from Heq-at, I have not turned a deaf      
ear to the words of truth.                                                  
                                                    {APPENDIX ^paragraph 25}
  Hail, Ser-Kheru, who comest forth from Unes, I have not stirred up        
strife.                                                                     
  Hail, Basti, who comest forth from Shetait, I have made none to           
weep.                                                                       
  Hail, Her-f-ha-f, who comest forth from thy cavern, I have not            
committed acts of sexual impurity, or lain with men.                        
  Hail, Ta-ret, who comest forth from Akhkhu, I have not eaten my           
heart.                                                                      
  Hail, Kenmti, who comest forth from Kenmet, I have cursed no man.         
                                                    {APPENDIX ^paragraph 30}
  Hail, An-hetep-f, who comest forth from Sau, I have not acted in a        
violent or oppressive manner.                                               
  Hail, Neb-heru, who comest forth from Tchefet, I have not acted           
[or judged] hastily.                                                        
  Hail, Serekhi, who comest forth from Unth, I have not.... my hair, I      
have not harmed the god.                                                    
  Hail, Neb-abui, who comest forth from Sauti, I have not multiplied        
my speech overmuch.                                                         
  Hail, Nefer-Tem, who comest forth from Het-ka-Ptah, I have not acted      
with deciet, I have not worked wickedness.                                  
                                                    {APPENDIX ^paragraph 35}
  Hail, Tem-Sep, who comest forth from Tetu, I have not done things to      
effect the cursing of [the king].                                           
  Hail, Ari-em-ab-f, who comest forth from Tebti, I have not stopped        
the flow of water.                                                          
  Hail, Ahi-mu, who comest forth from Nu, I have not raised my voice.       
  Hail, Utu-rekhit, who comest forth from thy house, I have not             
curse God.                                                                  
  Hail, Neheb-Nefert, who comest forth from the Lake of Nefer, I            
have not acted with insufferable insolence.                                 
                                                    {APPENDIX ^paragraph 40}
  Hail, Neheb-kau, who comest forth from [thy] city, I have not sought      
to make myself unduly distinguished.                                        
  Hail, Tcheser-tep, who comest forth from thy cavern, I have not           
increased my wealth except through such things are [justly] my own          
possessions.                                                                
  Hail, An-a-f, who comest forth from Auker, I have not scorned [or         
treated with contempt] the god of my town.                                  
-                                                                           
-                                                                           
  ADDRESS TO THE GODS OF THE TUAT                                           
                                                    {APPENDIX ^paragraph 45}
  (From the Papyrus of Nu, Brit. Mus. No. 10477, Sheet 24)                  
-                                                                           
  THE FOLLOWING ARE THE WORDS WHICH THE HEART OF TRUTH THAT IS SINLESS      
SHALL SAY WHEN HE COMETH WITH THE WORD OF TRUTH INTO THE HALL OF            
MAATI; THEY SHALL BE SAID WHEN HE COMETH TO THE GODS WHO DWELL IN           
THE TUAT; AND THEY ARE THE WORDS WHICH ARE [TO BE SAID] AFTER [HE           
COMETH FORTH FROM] THE HALL OF MAATI.                                       
-                                                                           
  Nu, the steward of the keeper of the seal, whose word is truth,           
saith:- Homage to you, O ye gods who dwell in your Hall of Maati! I         
know you, I know your names. Let me not fall under your knives of           
slaughter, and bring ye not forward my wickedness to this god in whose      
following ye are. Let not evil hap come upon me through you. Speak          
ye the truth concerning me in the presence of Neb-er-tcher, for I have      
done what is right and just in Ta-Mera. I have not cursed the god, and      
my evil hap did not come upon him that was king in his day.                 
                                                    {APPENDIX ^paragraph 50}
  Homage to you, O ye who dwell in your Hall of Maati, who have             
nothing false in your bodies, who live upon Truth, who feed yourselves      
upon Truth in the presence of Horus who dwelleth in his Disk,               
deliver ye me from Beba, who feedeth upon the livers of the great ones      
on the day of the Great Judgment. Grant ye that I may come before you,      
for I have not committed sin, I have done no act of deceit, I have          
done no evil thing, and I have not borne [false] witness; therefore         
let nothing [evil] be done to me. I have lived upon truth, I have           
fed upon truth, I have performed the ordinances of men, and the things      
which gratify the gods. I have propitiated the god by doing his             
will, I have given bread to the hungry man, and water to him that           
was athirst, and apparel to the naked man, and a ferry-boat to him          
that had no boat. I have made propitiatory offerings and given cakes        
to the gods, and the "things which appear at the word" to the Spirits.      
Deliver then ye me, protect then ye me, and make ye no report               
against me in the presence [of the Great God]. I am pure in respect of      
my mouth, and I am clean in respect of my hands, therefore let it be        
said unto me by those who shall behold me: "Come in peace, Come in          
peace." For I have heard that great word which the Sahu spake to the        
CAT, in the House of Hapt-ra. I have borne witness to Her-f-ha-f,           
and he hath given a decision [concerning me]. I have seen the things        
over which the Persea tree which is in Rasta, spreadeth its                 
branches. I have made petitions to the gods, [and I] know the things        
[which appertain to] their bodies. I have come, travelling a long           
road, to bear righteous testimony, and to set the Balance upon its          
supports within Aukert.                                                     
  Hail, thou who art exalted high upon thy standard, thou Lord of           
the Atef Crown, who dost make thy name to be "Lord of the Winds,"           
deliver thou me from thy divine Envoys who punish and afflict               
according to [thy] decrees, and who make calamities to arise, and           
whose faces are without coverings, for I have done what is right and        
true for the Lord of Truth. I am pure. My breast is purified by             
libations, and my hinder parts are made clean with the things which         
make clean, and my inner parts have been dipped in the Lake of              
Truth. There is no single member of mine which lacketh truth. I have        
washed myself clean in the Lake of the South. I have rested myself          
in the City of the North, which is in Sekhet Sanhemu (the Field of the      
Grasshoppers), where the mariners of Ra wash themselves clean at the        
second hour of the night, and at the third hour of the day. The hearts      
of the gods are gratified when they have passed over it, whether it be      
by night or whether it be by day, and they say unto me, "Let thyself        
advance." They say unto me, "Who art thou?" And they say unto me,           
"What is thy name?" [And I reply], "Sept-kheri-nehait-ammi-beq-f" is        
my name. Then they say unto me, "Advance straightway on the city which      
is to the North of the Olive Tree. What dost thou see there?" The           
Leg and the Thigh. What dost thou say unto them? Let me see rejoicings      
in these lands of the Fenkhu. What do they give unto thee? A flame          
of fire and a sceptre-amulet [made] of crystal. What dost thou do with      
them? I bury them on the furrow of M'naat, as things for the night.         
What dost thou find on the furrow of Maat? A sceptre of flint, the          
name of which is "Giver of winds." What now didst thou do with the          
flame of fire and the sceptre-amulet [made] of crystal, after thou          
didst bury them? I said a spell over them, and I dug them up. I             
quenched the flame of fire and I broke the sceptre-amulet, and I            
made a lake of water. [Then shall the Two and forty gods say unto me]:      
"Come now, pass in over the threshold of this door of the Hall of           
Maati, for thou hast knowledge of us." "We will not allow thee to           
enter in over us," say the bars of this door, "unless thou tellest          
us our names." [And I reply], "Tekh-bu-maa" is your name. The right         
lintel of this door saith: "I will not allow thee to pass over me           
unless thou tellest me my name." [And I reply], "Henku-en-fat-maat" is      
thy name.  The left lintel of this door saith: "I will not allow            
thee to pass over me unless thou tellest me my name." [And I reply],        
"Henku-en-arp" is thy name. The ground of this door saith: "I will not      
allow thee to pass over me unless thou tellest me my name." [And I          
reply], "Aua-en-Keb" is thy name. And the bolt of this door saith:          
"I will not open the door to thee unless thou tellest me my name."          
[And I reply], "Saah-en-mut-f" is thy name. The socket of the               
fastening of this door saith: "I will not open unto thee unless thou        
tellest my name." [And I reply], "The Living Eye of Sebek, the Lord of      
Bakhau," is thy name. The Doorkeeper of this door saith: "I will not        
open to thee, and I will not let thee enter by me unless thou               
tellest my name." [And I reply], "Elbow of the god Shu who placeth          
himself to protect Osiris" is thy name. The posts of this door say:         
"We will not let thee pass in by us unless thou tellest our name."          
[And I reply], "Children of the uraei-goddesses" is your name. The          
Doorkeeper of this door saith: "I will not open to thee, and I will         
not let thee enter in by me unless thou tellest my name. [And I             
reply], "Ox of Keb" is thy name. [And they reply], "Thou knowest us,        
pass in therefore by us." The ground of this Hall of Maati saith: "I        
will not let thee tread upon me [unless thou tellest me my name],           
for I am silent. I am holy because I know the names of two feet             
wherewith thou wouldst walk upon me. Declare, then, them to me."            
[And I reply], "Besu-Ahu" is the name of my right foot, and                 
"Unpet-ent-Het-Heru" is the name of my left foot. [The ground               
replieth]: "Thou knowest us, enter in therefore over us." The               
Doorkeeper of this Hall of Maati saith: "I will not announce thee           
unless thou tellest my name." [And I reply], "Discerner of hearts,          
searcher of bellies" is thy name. [The Doorkeeper saith]: "Thou             
shalt be announced." [He saith]: "Who is the god who dwelleth in his        
hour? Speak it" [And I reply], "Au-taui." [He saith]: "Explain who          
he is." [And I reply], "Au-taui" is Thoth. "Come now," saith Thoth,         
"for what purpose hast thou come?" [And I reply]: "I have come, and         
have journeyed hither that my name may be announced [to the god]."          
[Thoth saith]: "In what condition art thou?" [And I reply], "I, even        
I, am purified from evil defects, and I am wholly free from the curses      
of those who live in their days, and I am not one of their number."         
[Thoth saith]: "Therefore shall [thy name] be announced to the god."        
[Thoth saith]: "Tell me, who is he whose heaven is of fire, whose           
walls are living serpents, and whose ground is a stream of water?           
Who is he?" [And I reply], "He is Osiris." [Thoth saith]: "Advance          
now, [thy name] shall be announced to him. Thy cakes shall come from        
the Utchat (Eye of Horus or Ra), thy ale shall come from the Utchat,        
and the offerings which shall appear to thee at the word upon earth         
[shall proceed] from the Utchat." This is what Osiris hath decreed for      
the steward of the overseer of the seal, Nu, whose word is truth.           
-                                                                           
  RUBRIC: THE MAKING OF THE REPRESENTATION OF WHAT SHALL HAPPEN IN          
THIS HALL OF MAATI. This Chapter shall be said by the deceased when he      
is cleansed and purified, and is arrayed in linen apparel, and is shod      
with sandals of white leather, and his eyes are painted with antimony,      
and his body is anointed with unguent made of myrrh. And he shall           
present as offerings oxen, and feathered fowl, and incense, and             
cakes and ale, and garden herbs. And behold, thou shalt draw a              
representation of this in colour upon a new tile moulded from earth         
upon which neither a pig nor any other animal hath trodden. And if          
this book be done [in writing, the deceased] shall flourish, and his        
children shall flourish, and [his name] shall never fall into               
oblivion, and he shall be as one who filleth the heart of the king and      
of his princes. And bread, and cakes, and sweetmeats, and wine, and         
pieces of flesh shall be given unto him [from among those which are]        
upon the altar of the Great God. And he shall not be driven back            
from any door in Amentet, and he shall be led along with the kings          
of the South and the kings of the North, and he shall be among the          
bodyguard of Osiris, continually and regularly for ever. [And he shall      
come forth in every form he pleaseth as a living soul for ever, and         
ever, and ever.]                                                            
                                                                            
DEIFICATION_OF_THE_MEMBERS                                                  
  THE CHAPTER OF THE DEIFICATION OF THE MEMBERS                             
-                                                                           
  The hair of the Osiris Ani, whose word is truth, is the hair of Nu.       
  The face of the Osiris Ani, whose word is truth, is the face of Ra.       
  The eyes of the Osiris Ani, whose word is truth, are the eyes of          
Hathor.                                                                     
  The ears of the Osiris Ani, whose word is truth, are the ears of          
Up-uatu.                                                                    
  The lips of the Osiris Ani, whose word is truth, are the lips of          
Anpu.                                                                       
                                   {DEIFICATION_OF_THE_MEMBERS ^paragraph 5}
  The teeth of the Osiris Ani, whose word is truth, are the teeth of        
Serqet.                                                                     
  The cheeks of the Osiris Ani, whose word is truth, are the cheeks of      
Isis.                                                                       
  The arms of the Osiris Ani, whose word is truth, are the arms of          
Ba-neb-Tetu.                                                                
  The neck of the Osiris Ani, whose word is truth, is the neck of           
Uatchit.                                                                    
  The throat of the Osiris Ani, whose word is truth, is the throat          
of Mert.                                                                    
                                  {DEIFICATION_OF_THE_MEMBERS ^paragraph 10}
  The breast of the Osiris Ani, whose word is truth, is the breast          
of the Lady of Sais.                                                        
  The backbone of the Osiris Ani, whose word is truth, is the backbone      
of Set.                                                                     
  The trunk of the Osiris Ani, whose word is truth, is the trunk of         
the Lords of Kher-aha.                                                      
  The flesh of the Osiris Ani, whose word is truth, is the flesh of         
Aa-shefit.                                                                  
  The belly of the Osiris Ani, whose word is truth, is the belly of         
Sekhmet.                                                                    
                                  {DEIFICATION_OF_THE_MEMBERS ^paragraph 15}
  The buttocks of the Osiris Ani, whose word is truth, are the              
buttocks of the Eye of Horus.                                               
  The phallus of the Osiris Ani, whose word is truth, is the phallus        
of Osiris.                                                                  
  The thighs of the Osiris Ani, whose word is truth, are the thighs of      
Nut.                                                                        
  The feet of the Osiris Ani, whose word is truth, are the feet of          
Ptah.                                                                       
  The fingers of the Osiris Ani, whose word is truth, are the               
fingers of Saah.                                                            
                                  {DEIFICATION_OF_THE_MEMBERS ^paragraph 20}
  The toes of the Osiris Ani, whose word is truth, are the toes of the      
Living Uraei.                                                               
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Pyramid of Pepi I, ll. 565ff.)                                  
-                                                                           
  The head of this Meri-Ra is the head of Horus; he cometh forth            
therefore and ascendeth into heaven.                                        
  The skull of this Pepi is the Dekan star of the god; he cometh forth      
therefore and ascendeth into heaven.                                        
  The brow of this Meri-Ra is the brow of..... and Nu; he cometh forth      
therefore and ascendeth into heaven.                                        
  The face of this Pepi is the face of Up-uatu; he cometh forth             
therefore and ascendeth into heaven.                                        
                                                     {APPENDIX ^paragraph 5}
  The eyes of this Meri-Ra are the eyes of the Great Lady, the first        
of the Souls of Anu; he cometh forth therefore and ascendeth into           
heaven.                                                                     
  The nose of this Pepi is the nose of Thoth; he cometh forth               
therefore and ascendeth into heaven.                                        
  The mouth of this Meri-Ra is the mouth of Khens-ur; he cometh             
forth therefore, and ascendeth therefore, and ascendeth therefore into      
heaven.                                                                     
  The tongue of this Pepi is the tongue of Maaa (Truth) in the Maat         
Boat; he cometh forth therefore and ascendeth into heaven.                  
  The teeth of this Pepi are the teeth of the Souls of [Anu]; he            
cometh forth therefore and ascendeth into heaven.                           
                                                    {APPENDIX ^paragraph 10}
  The lips of this Meri-Ra are the lips of........; he cometh forth         
therefore and ascendeth into heaven.                                        
  The chin of this Pepi is the chin of Nest-khent-Sekhem (the throne        
of the First Lady of Sekhem); he cometh forth therefore and                 
ascendeth into heaven.                                                      
  The thes bone of this Pepi is the thes bone of the Bull Sma; he           
cometh forth therefore and ascendeth into heaven.                           
  The soulders of this Pepi are the shoulders of Set; he cometh             
forth therefore and ascendeth into heaven.                                  
  [The...... of this Pepi].........; he cometh forth therefore and          
ascendeth into heaven.                                                      
                                                    {APPENDIX ^paragraph 15}
  [The......of this Pepi] ........of Baabu; he cometh forth                 
therefore and ascendeth into heaven.                                        
  The breast of this Meri-Ra is the breast of Bast; he cometh forth         
therefore and ascendeth into heaven.                                        
  The belly of this Meri-Ra is the belly of Nut; he cometh forth            
therefore and ascendeth into heaven.                                        
  [The........of this Pepi] ........; he cometh forth therefore and         
ascendeth into heaven.                                                      
  [The........of this Pepi] .......of the two Companies of the gods;        
he cometh forth therefore and ascendeth into heaven.                        
                                                    {APPENDIX ^paragraph 20}
  The two thighs of this Pepi are the two thighs of Heqet; he cometh        
forth therefore and ascendeth into heaven.                                  
  The buttocks of this Meri-Ra are like the Semktet Boat and the            
Mantchet Boat; he cometh forth therefore and ascendeth into heaven.         
  The phallus of this Pepi is the phallus of the Hep Bull; he cometh        
forth therefore and ascendeth into heaven.                                  
  The legs of this Meri-Ra are the legs of Net (Neith) and Serqet;          
he cometh forth therefore and ascendeth into heaven.                        
  The knees of this Meri-Ra are the knees of the twin Souls who are at      
the head of the Sekhet-Tcher; he cometh forth therefore and                 
ascendeth into heaven.                                                      
                                                    {APPENDIX ^paragraph 25}
  The soles of this Meri-Ra are like the Maati Boat; he cometh forth        
therefore and ascendeth into heaven.                                        
  The toes of this Pepi are the toes of the Souls of Anu; he cometh         
forth therefore and ascendeth into heaven.                                  
  Now this Pepi is a god, the son of a god; he cometh forth                 
therefore and ascendeth into heaven.                                        
  This Pepi is the son of Ra, who loveth him; he cometh forth               
therefore and ascendeth into heaven.                                        
  Ra hath sent forth Meri-Ra; he cometh forth therefore and                 
ascendeth into heaven.                                                      
                                                    {APPENDIX ^paragraph 30}
  Ra hath begotten [this] Pepi; he cometh forth therefore and               
ascendeth into heaven.                                                      
  Ra hath given birth to Pepi; he cometh forth therefore and ascendeth      
into heaven.                                                                
  This spell therefore is in the body of Meri-Ra; he cometh forth           
therefore and ascendeth into heaven.                                        
  This Meri-Ra is the Power, the Great Power, among the Great               
Council of Chiefs in Anu; he cometh forth therefore and ascendeth into      
heaven.                                                                     
  He worketh the boat; Pepi cometh forth therefore and ascendeth            
into heaven.                                                                
                                                    {APPENDIX ^paragraph 35}
  [Pepi is] Horus, the nursling, the child; Meri-Ra cometh forth            
therefore and ascendeth into heaven.                                        
  Pepi hath not had union with Nut, she hath not given her hands to         
him; he cometh forth therefore and ascendeth into heaven.                   
  Keb hath not removed the obstacles in his path; he cometh forth           
therefore and ascendeth into heaven.                                        
  No god hath smitten the steps of this Meri-Ra; he come forth              
therefore and ascendeth into heaven.                                        
  [Though] Pepi is not censed is not mourned, hath not washed               
himself in the vessel, hath not smelt the haunch, hath not carried the      
meat-offering, hath not ploughed the earth, hath not dedicated an           
offering, he cometh forth therefore and ascendeth into heaven.              
                                                    {APPENDIX ^paragraph 40}
  Behold, it is not this Pepi who hath said these things to you, O          
ye gods, it is Heka who hath said these things to you, O ye gods,           
and this Meri-Ra is the support which is under Heka; he cometh forth        
therefore and ascendeth into heaven.                                        
  Every god smiteth the feet of Pepi; he cometh forth therefore and         
ascendeth into heaven.                                                      
  He plougheth the earth, he dedicateth an offering, he bringeth the        
vessel of [blood], he smelleth the haunch, and he bringeth the meat         
offering; he cometh forth therefore and ascendeth into heaven.              
  Every god graspeth the hand of Meri-Ra in heaven,                         
-                                                                           
                                                    {APPENDIX ^paragraph 45}
      He conducteth him to the House of Horus in the sky.                   
      The word of his Double is truth before Keb.                           
-                                                                           
-                                                                           
  THE CHAPTER OF REPULSING SLAUGHTER IN HENSU                               
  (From the Papyrus of Nu, Sheet 6)                                         
                                                    {APPENDIX ^paragraph 50}
-                                                                           
  THE CHAPTER OF DRIVING BACK THE SLAUGHTERS WHICH ARE PERFORMED IN         
HENSU. The Osiris Nu, whose word is truth, saith:- O thou land of           
the Sceptre! O thou White Crown of the divine form! O thou rest of the      
ferry-boat! I am the Child. (Repeat four times). Hail, Abu-ur! Thou         
sayest daily: "The slaughter-block is made ready as thou knowest,           
and thou hast come to destruction." I am Ra, who stablisheth those who      
praise him. I am the Knot of the god in the Aser tree, the twice            
beautiful one, who is more splendid to-day than yesterday. (Repeat          
four times). I am Ra, who stablisheth those who praise him. I am the        
Knot of the god within the Aser tree, and my appearance is the              
appearance [of Ra] on this day.                                             
  My hair is the hair of Nu. My face is the face of the Disk. My            
eyes are the eyes of Hathor. My ears are the ears of Up-uat. My nose        
is the nose of Khenti-Khabas. My lips are the lips of Anpu. My teeth        
are the teeth of Serqet. My cheeks are the cheeks of the goddess Isis.      
My hands are the hands of Ba-neb-Tet. My forearms are the forearms          
of Neith, the Lady of Sais. My backbone is the backbone of Suti. My         
phallus is the phallus of Beba. My reins are the reins of the Lords of      
Kher-aha. My chest is the chest of Aa-shefit. My belly and back are         
the belly and back of Sekhmet. My buttocks are the buttocks of the Eye      
of Horus. My hips and legs are the hips and legs of Nut. My feet are        
the feet of Ptah. [My fingers] and my toes are the [fingers and]            
toes of the Living gods. There is no member of my body which is not         
the member of a god. Thoth protecteth my body altogether, and I am          
Ra day by day. I shall not be dragged back by my arms, and none             
shall lay violent hold upon my hands. And shall do me hurt neither          
men, nor gods, nor the Spirit-souls, nor the dead, nor any man, nor         
any pat-spirit, nor any rekhit-spirit, nor any hememet-spirit.              
  I am he who cometh forth advancing, whose name is unknown. I am           
Yesterday. "Seer of Millions of Years" is my name. I pass along, I          
pass along the paths of the divine celestial judges. I am the Lord          
of Eternity: I decree and I judge like Khepera. I am the Lord of the        
Urrt Crown. I am he who dwelleth in the Utchat and in the Egg, and          
it is granted unto me to live therein. I am he who dwelleth in the          
Utchat when it closeth, and I exist by the strength thereof. I come         
forth and I shine; I enter in and I come to life. I am in the               
Utchat, my seat is upon my throne, and I sit in the tent chamber            
before it. I am Horus. [I] traverse millions of years. I have               
decreed [the stablishing] of my throne, and I am the ruler thereof;         
and in very truth my mouth keepeth an even balance both in speech           
and in silence. In very truth my forms are inverted. I am Un-Nefer,         
from one period even unto another, and what I have is within me. I          
am the only One, who proceedeth from an only One, who goeth round           
about in his course. I am he who dwelleth in the Utchat. No evil thing      
of any shape or kind shall spring up against me, and no baleful             
object, and no harmful thing, and no disastrous thing shall happen          
unto me. I open the door in heaven. I rule my throne. I open the way        
for the births which take place on this day. I am the child who             
traverseth the road of Yesterday. I am To-day for untold nations and        
peoples. I am he who protecteth you for millions of years. Whether          
ye be denizens of heaven, or of the earth, or of the South, or of           
the North, or of the East, or of the West, the fear of me is in your        
bodies. I am he whose being hath been wrought in his eye. I shall           
not die again. My moment is in your bodies, but my forms are in my          
place of habitation. I am "He who cannot be known." The Red Fiends          
have their faces directed against me. I am the unveiled one. The            
period when the heavens were created for me and were enlarged the           
bounds of earth, and multiplied the progeny thereof, cannot be found        
out. They shall fail and not be united again. By reason of the              
speech which I address to you, my name setteth itself apart from all        
things evil which are in the mouths of men. I am he who riseth and          
shineth, a wall which cometh out of a wall, an only One who proceedeth      
from an only One. There is never a day that passeth without the things      
which appertain unto him being therein; passing, passing, passing,          
passing. Verily I say unto thee, I am the Plant which cometh forth          
from Nu, and my mother is Nut. Hail, my creator, I am he who hath no        
power to walk, the Great Knot who dwelleth in Yesterday. The might          
of my strength is within my hand, I am not known [by thee], but I am        
he who knoweth thee. I cannot be held in the hand, but I am he who can      
hold thee in his hand. Hail, O Egg! Hail, O Egg! I am Horus who liveth      
for millions of years, whose flame shineth upon you, and bringeth your      
hearts unto me. I am master of my throne. I advance at this season.         
I have opened a path. I have delivered myself from all evil things.         
I am the golden dog-headed ape, three palms and two fingers [high],         
which hath neither arms nor legs, and which dwelleth in Het-ka-Ptah. I      
go forth as goeth forth the dog-headed ape who dwelleth in                  
Het-ka-Ptah.                                                                
-                                                                           
                                                    {APPENDIX ^paragraph 55}
  RUBRIC: Behold the Osiris Ani, whose word is truth, arrayed in            
fine linen, and shod with sandals of white [leather], and anointed          
with the very finest myrrh unguent. There are offered unto him a            
fine bull, and incense, and ra geese, and flowers, and ale, and cakes,      
and garden herbs. And behold, thou shalt draw a representation of a         
table of offerings on a clean tile with pure colours, and thou shalt        
bury it in a field whereon no swine hath trodden. And if a copy of          
this book be written upon it, he shall rise [again], and his                
children's children shall flourish and prosper, like unto Ra,               
without cessation. He shall be in high favour with the king, and            
with the shenit nobles of his court, and there shall be given unto him      
cakes and cups of drink, and portions of flesh, upon the altar-table        
of the Great God. He shall not thrust aside at any door in Amentet; he      
shall travel in the train of the Kings of the South and the Kings of        
the North, and he shall abide with the followers of Osiris near             
Un-Nefer, for ever, and for ever, and for ever.                             
-                                                                           
-                                                                           
  Vignette                                                                  
  (From the Papyrus of Nu, Sheet 24)                                        
-                                                                           
                                                    {APPENDIX ^paragraph 60}
  The steward of the overseer of the seal, Nu, whose word is truth,         
begotten of the steward of the overseer of the seal, Amen-hetep, whose      
word is truth, saith:- Hail, ye Four Apes who sit in the bows of the        
Boat of Ra, who convey truth to Nebertcher, who sit in judgment on the      
oppressed man and on [his] oppressor, who make the gods to be               
contented by means of the flame of your mouths, who offer holy              
offerings to the gods, and sepulchral meals to the Spirit-souls, who        
live upon truth, and who feed upon truth of heart, who are without          
deceit and fraud, and to whom wickedness is an abomination, do ye away      
with my evil deeds, and put ye away my sins [which deserved stripes         
upon earth, and destroy ye every evil thing which appertaineth to me],      
and let there be no obstacle whatsoever on my part towards you. O           
grant ye that I may make my way through the Amehet, let me enter            
into Rasta, let me pass through the hidden pylons of Ament. O grant         
that there may be given unto me shens cakes, and ale, and persen            
cakes, even as to the living Spirit-souls, and grant that I may             
enter into and come forth from Rasta.                                       
  [The Four Apes make answer, saying]: Come thou, for we have done          
away with thy wickedness, and we have put away thy sin, along with thy      
sins upon earth which deserved stripes, and we have destroyed every         
evil thing which appertained to thee upon earth. Enter, therefore,          
unto Rasta, and pass through the hidden pylons of Amentet, and there        
shall be given unto thee shens cakes, and ale, and persen cakes, and        
thou shalt come forth and shalt enter in at thy desire, even as do          
those who are favoured [of the God], and thou shalt be called [to           
partake of offerings] each day in the horizon.                              
                                                                            
THE_TET_OF_GOLD                                                             
-                                                                           
  THE CHAPTER OF A TET OF GOLD. The Osiris Ani, whose word is truth,        
saith:- Thou risest up for thyself, O Still-heart! Thou shinest for         
thyself, O Still-heart! Place thou thyself on thy base, I come, I           
bring unto thee a Tet of gold, thou shalt rejoice therein.                  
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nebseni and the Papyrus of Nu)                       
-                                                                           
  Rise up thou, O Osiris, thou hast thy backbaone, O Still-heart, thou      
hast thy neck vertebrae and thy back, O Still-heart! Place thou             
thyself on thy base. I put water beneath thee, and I bring unto thee a      
Tet of god that thou mayest rejoice therein.                                
-                                                                           
  RUBRIC (From the Papyrus of Nu): [This Chapter] shall be recited          
over a Tet of gold set in a stand made of sycamore wood which hath          
been steeped in a tincture of ankhamu flowers, and it shall be              
placed on the neck of the deceased on the day of the funeral. If            
this amulet be placed on his neck he shall become a perfect Khu in          
Khert-Neter, and at the festivals of the New Year he shall be like          
unto the Followers of Osiris continually and for ever.                      
-                                                                           
                                                     {APPENDIX ^paragraph 5}
  RUBRIC (From the Turin Papyrus): [This Chapter] shall be said over a      
Tet of gold fashioned out of the trunk of a sycamore tree, and it           
shall be placed on the neck of the deceased. Then shall he enter in         
through the doors of the Tuat. His words whall be silenced. He shall        
place himself on the ground on New Year's Day among the Followers of        
Osiris.                                                                     
  If this Chapter be known by the deceased he shall live like a             
perfect Khu in Khert-Neter. He shall not be sent back from the doors        
of Amentet. There shall be given to him the shens cake, and a cup of        
wine, and the persen cake, and slices of meat on the altars of Ra,          
or as some read, Osiris Un-Nefer. And his word shall be truth before        
his enemies in Khert-Neter continually, and for ever and for ever.          
                                                                            
THE_TET_OF_RED_STONE                                                        
-                                                                           
  THE CHAPTER OF A TET OF CARNELIAN. The Osiris Ani, whose word is          
truth, saith:- The blood of Isis, the spells of Isis, the magical           
powers of Isis, shall make this great one strong, and shall be an           
amulet of protection [against him] that would do to him the things          
which he abominateth.                                                       
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
-                                                                           
  RUBRIC (From the Papyrus of Nu): [This Chapter] shall be said over a      
Tet of carnelian, which hath been washed in a tincture of ankhamu           
flowers, and is fashioned out of the trunk of a sycamore tree. It           
shall be placed on the neck of the deceased on the day of the funeral.      
If this be done for him the magical powers of Isis will protect his         
members. Horus, the son of Isis, shall rejoice when he seeth him. [No]      
road shall be blocked to him. His hand shall be to heaven, his hand         
shall be to earth, for ever. Do not let anyone see him. Verily....          
-                                                                           
  RUBRIC (From the Saite Recension): [This Chapter] shall be said over      
a Tet of carnelian, anointed with a tincture of ankhamu flowers,            
made from the trunk of a sycamore tree. It shall be placed on the neck      
of the Khu. If this book be done for him, the magical spells of Isis        
shall protect him, and Horus the son of Isis shall rejoice [when] he        
seeth him. No road shall be blocked to him. His hand shall be to            
heaven, his hand shall be to earth....... If this book be known by him      
he shall be in the following of Osiris Un-Nefer, and his word shall be      
truth in Khert-Neter. The doors in Khert-Neter shall be opened to him.      
Wheat and barley shall be given to him in Sekhet-Aanru. His name shall      
be like [the names of] the gods who are there, the Followers of             
Horus who reap.                                                             
                                                                            
HEART_OF_SEHERT_STONE                                                       
-                                                                           
  THE CHAPTER OF A HEART OF SEHERT STONE. The Osiris Ani, whose word        
is truth, saith:- I am the Benu bird, the Heart-soul of Ra, the             
guide of the gods to the Tuat. Their Heart-souls come forth upon earth      
to do what their KAU wish to do, and the Heart-soul of the Osiris           
Ani shall come forth to do what his Ka wisheth to do.                       
                                                                            
THE_HEAD_REST                                                               
-                                                                           
  THE CHAPTER OF THE HEAD-REST, which is to be placed under the head        
of the Osiris Ani, whose word is truth. Awake out of thy sufferings, O      
thou who liest prostrate! Awake thou! Thy head is in the horizon. I         
lift thee up, O thou whose word is truth. Ptah hath overthrown thine        
enemies for thee. Thine enemies have fallen, and they shall never more      
exist, O Osiris.                                                            
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nebseni, Sheet 21)                                   
-                                                                           
  THE CHAPTER OF THE HEAD-REST [OR PILLOW]. Awake out of thy                
sufferings, O thou who liest prostrate. They (the gods) keep watch          
over thy head in the horizon. Thou art lifted up, thy word is truth in      
respect of the things which have been done by thee. Ptah hath cast          
down headlong thine enemies. This work was ordered to be done for           
thee. Thou art Horus, the son of Hathor, Nesert, Nesertet, who              
giveth back the head after it hath been cut off. Thy head shall not be      
carried away from thee, after [it hath been cut off]; thy head shall        
be carried away from thee, never, never!                                    
                                                                            
TEXTS_IN_THE_FUNERAL_CHAMBER                                                
  THE TEXTS IN THE FUNERAL CHAMBER                                          
-                                                                           
  SPEECH OF ISIS. Isis saith:- I have come to be a protector unto           
thee. I waft unto thee air for thy nostrils, and the north wind             
which cometh forth from the god Tem unto thy nose. I have made whole        
for thee thy windpipe. I make thee to live like a god. Thine enemies        
have fallen under thy feet. I have made thy word to be true before          
Nut, and thou art mighty before the gods.                                   
-                                                                           
  SPEECH OF NEPHTHYS. Nephthys saith unto the Osiris Ani, whose word        
is truth:- I go round about thee to protect thee, O brother Osiris.         
I have come to be a protector unto thee. [My strength shall be near         
thee, my strength shall be near thee, for ever. Ra hath heard thy cry,      
and the gods have made thy word to be truth. Thou art raised up. Thy        
word is truth in respect of what hath been done unto thee. Ptah hath        
overthrown thy foes, and thou art Horus, the son of Hathor.]                
-                                                                           
  SPEECH OF THE TET. I have come quickly, and I have driven back the        
footsteps of th god whose face is hidden. I have illumined his              
sanctuary. I stand near the god Tet on the day of repelling                 
disaster. I watch to protect thee, O Osiris.                                
                                 {TEXTS_IN_THE_FUNERAL_CHAMBER ^paragraph 5}
-                                                                           
  SPEECH OF KESTA (Mesta). I am Kesta, thy son, O Osiris Ani, whose         
word is truth. I come to protect thee. I will make thy house to             
flourish, permanently, even as Ptah hath commanded me, and as Ra            
himself hath commanded.                                                     
-                                                                           
  SPEECH OF HAPI. I am Hapi, thy son, O Osiris Ani, whose word is           
truth. I come to protect thee. I bind together thy head and the             
members of thy body. I smite down for thee thine enemies under thee. I      
give unto thee thy head for ever and for ever, O Osiris Ani, whose          
word is truth, whose word is truth in peace.                                
-                                                                           
                                {TEXTS_IN_THE_FUNERAL_CHAMBER ^paragraph 10}
  SPEECH OF TUAMUTEF. Tuamutef saith:- I am thy son Horus, who              
loveth thee. I come to avenge thee, O my father Osiris, upon him            
that did evil unto thee. I have set him under thy feet for ever and         
for ever, permanently, permanently, O Osiris Ani, whose word is truth,      
whose word is truth.                                                        
-                                                                           
  SPEECH OF QEBHSENUF. Qebsenuf saith:- I am thy son, O Osiris Ani,         
whose word is truth. I come to protect thee. I have collected thy           
bones and I have gathered together thy members. [I have brought thy         
heart, and I have placed it upon its throne within thy body. I make         
thy house to flourish after thee, O thou who livest for ever.]              
-                                                                           
  SPEECH OF THE FLAME. I protect thee with this flame. I drive him          
[the foe] away from the valley of the tomb. I cast the sand about [thy      
feet]. I embrace the Osiris Ani, whose word is truth, in peace.             
                                {TEXTS_IN_THE_FUNERAL_CHAMBER ^paragraph 15}
-                                                                           
  SPEECH OF THE FLAME. I come to hew in pieces. I have not been hewn        
in pieces, and I will not permit thee to be hewn in pieces. I come          
to do violence [to thy foe], but I will not permit violence to be done      
unto thee. I protect thee.                                                  
-                                                                           
  A SOUL SAITH:- The Osiris Ani, whose is truth, praiseth Ra when he        
rolleth up into the sky in the eastern horizon of heaven.                   
-                                                                           
                                {TEXTS_IN_THE_FUNERAL_CHAMBER ^paragraph 20}
  A SOUL SAITH:- The Osiris Ani, whose word is truth, in peace in           
Khert-Neter, praiseth Ra when he setteth in the western horizon of          
heaven, [and saith], "I am a perfect soul."                                 
-                                                                           
  SPEECH OF ANI. The Osiris Ani, whose word is truth, saith:- I am a        
perfect soul dwelling in the divine egg of the Abtu Fish. I am the          
Great Cat which dwelleth in the Seat of Truth, wherein the god Shu          
riseth.                                                                     
-                                                                           
  SPEECH OF THE USHABTI FIGURE [THE CHAPTER OF NOT DOING WORK IN            
KHERT-NETER]. Illumine the Osiris Ani, whose word is truth. Hail,           
Shabti Figure! If the Osiris Ani be decreed to do any of the work           
which is to be done in Khert-Neter, let everything which standeth in        
the way be removed from him- whether it be to plough the fields, or to      
fill the channels with water, or to carry sand from [the East to the        
West]. The Shabti Figure replieth: I will do it, verily I am here           
[when] thou callest.                                                        
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu and the Papyrus of Nebseni)                       
-                                                                           
  The Speech of Anpu:  Anubis the dweller in the mummy chamber,             
Governor of the Divine House, layeth his hands upon the lord of             
life, the scribe, the draughtsman of Ptah, Nebseni, the lord of             
fealty, begotten of the scribe and mason Thena, born of the lady of         
the house Mut-rest, whose word is truth, and devoting himself to him        
as his guardian, saith:- Homage to thee, thou happy one, lord! Thou         
seest the Utchat. Ptah-Seker hath bound thee up. Anpu hath exalted          
thee. Shu hath raised thee up, O Beautiful Face, thou governor of           
eternity. Thou hast thine eye, O scribe Nebseni, lord of fealty, and        
it is beautiful. Thy right eye is like the Sektet Boat, thy left eye        
is like the Atet Boat. Thine eyebrows are fair to see in the                
presence of the Company of the Gods. Thy brow is under the                  
protection of Anpu, and thy head and face, O beautiful one, are before      
the holy Hawk. Thy fingers have been stablished by thy scribe's             
craft in the presence of the Lord of Khemenu, Thoth, who hath bestowed      
upon thee the knowledge of the speech of the holy books. Thy beard          
is beautiful in the sight of Ptah-Seker, and thou, O scribe Nebseni,        
thou lord of fealty, art beautiful before the Great Company of the          
Gods. The Great God looketh upon thee, and he leadeth thee along the        
path of happiness. Sepulchral meals are bestowed upon thee, and he          
overthroweth for thee thine enemies, setting them under thy feet in         
the presence of the Great Company of the Gods who dwell in the House        
of the Great Aged One which is in Anu.                                      
                                                                            
SEKHET_HETEPET                                                              
-                                                                           
  [HERE] BEGIN THE CHAPTERS OF SEKHET-HETEPET, AND THE CHAPTERS OF          
COMING FORTH BY DAY, OF ENTERING INTO AND COMING FORTH FROM                 
KHERT-NETER, OF ARRIVING IN SEKHET-AANRU, AND OF LIVING IN PEACE IN         
THE GREAT CITY, THE LADY OF WINDS. [The Osiris the scribe Ani, whose        
word is truth, saith:-] Let me be master there. Let me be a khu there.      
Let me plough there. Let me reap there. Let me eat there. Let me drink      
there. [Let me beget there]. Let me do there all the things which           
one doeth upon earth. The Osiris Ani, whose word is truth, saith:-          
Horus vanquished Set when [he] looked at the building of                    
Sekhet-Hetepet. [He] spread air over the Divine Soul in its Egg, in         
its day. He delivered the interior of the body of Horus [from the           
Akeru Gods]. I have crowned him in the House of Shu. His house is           
the stars. Behold, I take up my place in its nomes. He hath guided the      
hearts of the Company of the Firstborn Gods. He hath reconciled the         
Two Fighters (Horus and Set), the guardians of life. He hath done what      
is fair, bringing an offering. He hath reconciled the Two Fighters          
with him that belongeth to them. He hath cut off the hairy scalp of         
the Two Fighters. He hath destroyed the revolts of [their] children. I      
have done away all the evil which attacked their souls. I am master in      
[Sekhet-Hetepet]. I know it. I have sailed over its lakes that I might      
arrive at the cities thereof. I have made strong my mouth. The              
Spirit-souls are ready [to fight], but they shall not gain the mastery      
over me. I am equipped in thy Fields, O god Hetep. What thou wishest        
thou shalt do, [saith this god].                                            
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nebseni, Sheet 17)                                   
-                                                                           
  HERE BEGIN THE CHAPTERS OF SEKHET-HETEPET, AND THE CHAPTERS OF            
COMING FORTH BY DAY; OF GOING INTO AND OF COMING FORTH FROM                 
KHERT-NETER; OF ARRIVAL IN SEKHET-AARU; OF LIVING IN SEKHET-HETEPET,        
THE MIGHTY CITY, THE LADY OF WINDS; OF HAVING POWER THEREIN; OF             
BECOMING A SPIRIT-SOUL THERE; OF PLOUGHING THERE; OF REAPING THERE; OF      
EATING THERE; OF DRINKING THERE; OF MAKING LOVE THERE; AND OF DOING         
EVERYTHING THERE EVEN AS A MAN DOETH UPON EARTH. NEBSENI, THE SCRIBE        
AND DRAUGHTSMAN OF PTAH, SAITH:- Set vanguished Horus, who was looking      
at the building in Sekhet-Hetepet. I set free Horus from Set. Set           
opened the paths of the Two Eyes (the Sun and Moon) in the sky. Set         
ejected water with air upon the soul of his Eye, which dwelt in the         
town of Mert; he delivered the interior of the body of Horus from           
the hands of the Akeru Gods. Behold me! I paddle this great boat            
over the Lake of the god Hetep; I seized upon it in the mansion of          
Shu. The mansion of his stars reneweth youth, reneweth youth. I paddle      
over the Lakes thereof so that I may arrive at the towns thereof. I         
sail up to the town of the god Hetep.... Behold, I am at peace with         
his times, and with his guidance, and with his will, and with the           
Company of the Gods, who are his firstborn. He maketh the Two Fighters      
(Horus and Set) to be at peace [with each other], and to keep ward          
over the living whom he hath created in fair form, and he bringeth          
peace; he maketh the Two Fighters to be at peace with those who             
watch over them. He cutteth off the hair from their divine fighters,        
he driveth away storm from the children. He guardeth from attack the        
Spirits. I have gained power therein. I know it. I have sailed over         
its Lakes so that I might arrive at its towns. My mouth is strong. I        
am equipped against the Spirits. They shall not gain the mastery            
over me. I am rewarded [with] these thy Fields, O god Hetep. What thou      
wishest that do thou, O lord of the winds. I shall be a spirit              
therein. I shall eat therein. I shall drink therein. I shall plough         
therein. I shall reap the grain therein. I shall be strong therein.         
I shall make love therein. My words shall be strong therein. I shall        
not be in subjection therein. I shall be a man of might therein.            
Thou hast made strong the mouth and throat. Hetep Qettbu is its             
name. [It is] stablished upon the pillars of Shu, and is linked with        
the pleasant things of Ra. He is the divider of years, the hidden of        
mouth; silent is his mouth, hidden is what he uttereth, he                  
fulfilleth eternity, he taketh possession of everlastingness of             
existence as Hetep, Neb-Hetep. Horus maketh himself strong like unto a      
hawk which is one thousand cubits in length, and two thousand cubits        
in life. He that equipments with him, he journeyeth on, he cometh to        
the place where his heart would be, among the Lakes which are in its        
towns. He begetteth in the birth-chamber of the god of the town, he is      
satisfied with the food of the god of the town; he doeth what ought to      
be done there, in the Field of Smas-er-Khet..... everything of the          
birth-chamber of the god of the town. Now [when he] setteth in the          
[land of] life like crystal he performeth everything therein, [which        
things are] like unto the things done in the Lake Neserser, wherein         
there is none that rejoiceth, and wherein are evil things of all            
kinds. The god Hetep goeth in and cometh out, and marcheth hither           
and thither in the Field of Smas-er-Khet, the Lady of the                   
birth-chamber of the god of the town. [Let me] live with the god            
Hetep, clothed, and not despoiled by the Lords of the North, and may        
the Lord of things bring food unto me. May he make me to go forward.        
May I come forth. May he bring to me my Power there, may I receive it,      
and may I be rewarded by the god Hetep. May I be master of the great        
and mighty word in my body in this my place. Make me to remember it.        
Let me [not] forget it. Let me go forward, let me plough. I am at           
peace with the god of the town. I know the water, the towns, the            
nomes, and the lakes which are in Sekhet-Hetepet. I live therein. I am      
strong therein. I shine therein. I eat therein. I..... therein. I reap      
the harvest therein. I plough therein. I beget children therein. I          
am at peace therein with the god Hetep. Behold I sow seed therein. I        
sail about on the lakes thereof, and I arrive at its towns, O god           
Hetep. Behold my mouth is equipped, it possesseth horns . Give unto me      
the abundance of the KAU (Doubles) and Spirit-souls. He who counteth        
me is Shu. I know him not. I come to its towns. I sail over its lakes.      
I walk about in Sekhet-Hetepet. Behold, it is Ra who is in heaven.          
Behold, it is Hetep [who is] its double offering of peace. I have           
advanced to its territory. I have put on my apparel. I have come            
forth. I have given what it was upon me to give. I have made glad in        
[my] heart. I have conquered. I am strong. I have given directions          
to Hetep.                                                                   
  [Hail], Unen-em-hetep, I have come to thee. My soul followeth me.         
The god Hu is on my hands. [Hail], Nebt-taui, in whom I remember and        
forget, I have become alive. I have attacked none, let none attack me.      
I have given, give thou to me gladness. Make thou me to be at peace,        
bind thou up my veins, let [me] receive air. [Hail], Unen-em-hetep,         
the Lord of Winds. I have come there. I have opened my head. Ra             
sleepeth. I watch not, [for] the goddess Hetemet is at the door of          
heaven by night. Obstacles have been put before, but I have                 
collected his emissions. I am in my city. O Nut-urt (Great City), I         
have come into thee. I have counted up my abundant stores. I advance        
on my way to Uakh. I am the Bull which is tied with a rope of               
lapis-lazuli, the lord of the Field of the Bull, the lord of the words      
of the god, the goddess Septet (Sothis) at her hours. O Uakh, I have        
come into thee. I have eaten my food. I am master of choice pieces          
of the flesh of oxen and of feathered fowl, and the birds of Shu            
have been given unto me. I follow the gods, and I come [after the           
Doubles]. O Tcheft, I have come into thee. I array myself in                
apparel, and I gird about myself the sat garment of Ra. Behold the          
Court of the sky, and the followers of Ra who dwell in heaven. O            
Un-em-hetep, the lord of the Two Lands, I have come into thee. I            
have plunged into the Lakes of Tchesert; behold, impurity of every          
kind hath removed from me. The divine Great One flourisheth therein.        
Behold, I have found [him]. I have netted geese, and have fed full          
upon the finest of them. O Qenqentet, I have come into thee. I have         
seen the Osiris [my father]. I have saluted my mother. I have begotten      
children. I have snared the serpents, and I am delivered. I know the        
name of the god who is with the goddess Tchesert, and who hath              
straight hair, and is equipped with horns [ready to gore]. He reapeth,      
and I both plough and reap. O Hetemet, I have entered into thee. I          
have approached the lapis-lazuli. I have followed the winds of the          
Company of the Gods. The Great God hath given my head unto me. He           
who hath bound my head on my body for me is the Mighty One, with            
eyes of lapis-lazuli, namely, Ari-en-ab-f ("He doeth as he pleaseth").      
O Usert, I have come into thee, to the house wherein food is brought        
unto me. O Smam, I have come into thee. My heart watcheth, my head          
is equipped with the White Crown. I act as the guide of the                 
celestial beings. I make to flourish terrestrial beings. There is           
joy of heart for the Bull, and for the celestial beings, and for the        
Company of the Gods. I am the god, the Bull, the Lord of the gods, who      
maketh his way over the turquoise. O wheat and barley of the nome of        
the god, I have come into thee. I have come forward. I have lifted          
[you] up, following the best offerings of the Company of the Gods. I        
have moored my boat to the tying-up post in the lakes of the celestial      
beings. I have pulled up the typing-up post. I have recited words, and      
I have ascribed praises unto the gods who dwell in Sekhet-Hetepet.          
                                                                            
PROVIDING_THE_DECEASED_WITH_MEAT_MILK_ETC                                   
  THE CHAPTER OF PROVIDING THE DECEASED WITH MEAT, MILK, ETC.               
-                                                                           
  The Osiris Ani, whose word is truth, saith:- Homage to thee, O Ra,        
the Lord of Truth, the Only One, the Lord of Eternity and Maker of          
Everlastingness. I have come before thee, O my Lord Ra. I would make        
to flourish the Seven Cows and their Bull. O ye who give cakes and ale      
to the Spirit-souls, grant ye that my soul may be with you. Let him be      
born on your thighs. Let him be like unto one of you for ever and           
for ever. Let the Osiris Ani, whose word is truth, have glorious power      
in the Beautiful Amentet.                                                   
-                                                                           
-                                                                           
  The Names of the Seven Holy Cows and their Bull:                          
-                                                                           
  1. Het-Kau Nebtertcher.                                                   
                    {PROVIDING_THE_DECEASED_WITH_MEAT_MILK_ETC ^paragraph 5}
  2. Akertkhentetasts.                                                      
  3. Khebitetsahneter.                                                      
  4. Urmertusteshertshenti.                                                 
  5. Khnemtemankhanuit.                                                     
  6. Sekhmetrensemabats.                                                    
                   {PROVIDING_THE_DECEASED_WITH_MEAT_MILK_ETC ^paragraph 10}
  7. Shenatpetuthestneter.                                                  
-                                                                           
  Bull:  Kathaihemt.                                                        
-                                                                           
-                                                                           
  ADDRESSES TO THE FOUR RUDDERS OF HEAVEN                                   
                   {PROVIDING_THE_DECEASED_WITH_MEAT_MILK_ETC ^paragraph 15}
-                                                                           
  Hail, thou Beautiful Power, thou Beautiful Rudder of the Northern         
Heaven.                                                                     
  Hail, thou who circlest, Guide of the Two Lands, Beautiful Rudder of      
the Western Heaven.                                                         
  Hail, Splendour, Dweller in the temple of the Ashemu gods, Beautiful      
Rudder of the Eastern Heaven.                                               
  Hail, Dweller in the temple of the Red gods, Beautiful Rudder of the      
Southern Heaven.                                                            
                   {PROVIDING_THE_DECEASED_WITH_MEAT_MILK_ETC ^paragraph 20}
-                                                                           
-                                                                           
-                                                                           
  ADDRESSES TO THE FOUR COMAPNIES OF THE GODS                               
-                                                                           
  Hail, ye gods who are above the earth, ye Guides of the Tuat.             
  Hail, ye Mother-goddesses, who are above the earth in Khert-Neter,        
in the House of Osiris.                                                     
                   {PROVIDING_THE_DECEASED_WITH_MEAT_MILK_ETC ^paragraph 25}
  Hail, ye gods who guide Ta-tchesert, who are above the earth and are      
guides of the Tuat.                                                         
  Hail, ye Followers of Ra, who follow in the train of Osiris.              
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Nu)                                                  
-                                                                           
  RUBRIC: [These words] shall be said when Ra appeareth over [figures]      
of these gods written in colour upon a tablet, and thou shalt place         
offerings of tchefau food before them, cakes, ale, flesh, geese, and        
incense. They shall cause the deceased to enjoy the "offerings which        
come forth at the word [of command]" before Ra; and they shall give         
the deceased an abundance of food in Khert-Neter, and shall deliver         
him from every evil thing whatsoever. And thou shalt not recite this        
Book of Un-Nefer in the presence of anyone except thine own self. If        
this be done for the deceased Ra shall be a rudder for him, and             
shall be to him a strong protecting power, and he shall destroy all         
his enemies for him in Khert-Neter, and in heaven, and upon earth, and      
in every place whereinsoever he may enter, and he shall enjoy               
celestial food regularly and continually for ever.                          
-                                                                           
-                                                                           
-                                                                           
  (From the Saite Recension)                                                
-                                                                           
                                                     {APPENDIX ^paragraph 5}
  THE BOOK OF MAKING PERFECT THE KHU in the heart of Ra, of making him      
to have the mastery before Tem, of magnifying him before Osiris, of         
making him mighty before Khent-Amentet, and of setting awe of him           
before the Company of the Gods. It shall be recited on the day of           
the New Moon, on the sixth day festival, on the fifteenth day               
festival, on the festival of Uak, on the festival of Thoth, on the          
Birthday of Osiris, on the festival of Menu, on the night of Heker,         
[during] the Mysteries of the Tuat, during the celebration of the           
Mysteries in Akertet, at the smiting of the emissions, at the               
passage of the Funerary Valley, [and] the Mysteries...... [The recital      
thereof] will make the heart of the Khu to flourish and will make long      
his strides, and will make him to advance, and will make his face           
bright, and will make it to penetrate to the God. Let no man witness        
[the recital] except the king and the Kherheb priest, but the               
servant who cometh to minister outside shall not see it. Of the Khu         
for whom this Book shall be recited, his soul shall come forth by           
day with the living, he shall have power among the gods, and it will        
make him irresisitible for ever and ever. These gods shall go round         
about him, and shall acknowledge him. He shall be one of them. [This        
Book] shall make him to know how he came into being in the                  
beginning. This Book is indeed a veritable mystery. Let no stranger         
anywhere have knowledge of it. Do not speak about it to any man. Do         
not repeat it. Let no [other] eye see it. Let no [other] ear hear           
it. Let no one see it except [thyself] and him who taught [it to            
thee]. Let not the multitude [know of it] except thyself and the            
beloved friend of thy heart. Thou shalt do this book in the seh             
chamber on a cloth painted with the stars in colour all over it. It is      
indeed a mystery. The dwellers in the swamps of the Delta nad               
everywhere there shall not know it. It shall provided the Khu with          
celestial food upon in Khert-Neter. It shall supply his Heart-soul          
with food upon earth. It shall make him to live for ever. No [evil]         
thing shall have the master over him.                                       
-                                                                           
  THE ADDRESSES OF THE FOUR RUDDERS                                         
-                                                                           
  Hail, Power of Heaven, Opener of the Disk, thou Beautiful Rudder          
of the Northern Heaven.                                                     
                                                    {APPENDIX ^paragraph 10}
  Hail, Ra, Guide of the Two Lands, thou Beautiful Rudder of the            
Western Heaven.                                                             
  Hail, Khu, Dweller in the House of the Akhemu gods, thou Beautiful        
Rudder of the Eastern Heaven.                                               
  Hail, Governor, Dweller in the House of the Tesheru Gods, thou            
Beautiful Rudder of the Southern Heaven.                                    
-                                                                           
  Grant ye cakes, and ale and tchefau food to the Osiris Auf-ankh,          
whose word is truth.                                                        
                                                    {APPENDIX ^paragraph 15}
-                                                                           
  Hail, Father of the Gods! Hail, Mother of teh Gods in Khert-Neter!        
Deliver ye the Osiris from every evil thing, from every evil                
obstruction, from every dire attack of an enemy, and from that              
deadly snarer with knife-like words, and from men, and gods, and            
Spirit-souls, and the damned, on this day, on this night, on this           
present festival of the fifteenth day, and in this year, and from           
the things of evil thereof.                                                 
                                                                            
HYMN_TO_OSIRIS_KHENTI_AMENTI_UN_NEFER                                       
  HYMN TO OSIRIS KHENTI-AMENTI UN-NEFER                                     
-                                                                           
  The Osiris Ani, whose word is truth, praiseth Osiris Khenti-Amenti        
Un-Nefer, and saith:- Hail, my Lord, who dost hasten through eternity,      
whose existence is for ever, Lord of Lords, King of Kings,                  
Sovereign, God of the Gods, who live in their shrines,.... gods....         
men. Make thou for me a seat with those who are in Khert-Neter, who         
adore the forms of thy KA, and who traverse millions of millions of         
years....... May no delay arise for thee in Ta-mera. Let them come          
to thee, all of them, great as well as small. May this god give the         
power to enterin and to come forth from Khert-Neter, without                
repulse, at any door of the Tuat, to the KA of the Osiris Ani.              
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  (From the Papyrus of Sutimes)                                             
-                                                                           
  SUTIMES, THE LIBATIONER AND PRESIDENT OF THE ALTAR CHAMBER OF THE         
APTS, DIRECTOR OF THE SCRIBES OF AMEN, WHOSE WORD IS TRUTH, PRAISETH        
OSIRIS, AND DOETH HOMAGE TO THE LORD OF ETERNITY, AND SATISFIETH THE        
WILL OF THE GOD, AND SPEAKETH TRUTH, THE LORD OF WHICH IS UNKNOWN, AND      
SAITH:- Homage to thee, O thou Holy God, thou mighty and beneficent         
being, thou Prince of Eternity, who dwellest in thy abode in the            
Sektet Boat, whose risings are manifold in the Atet Boat, unto whom         
praises are rendered in heaven and upon earth. Peoples and nations          
exalt thee, and the awe of thy terror is in the hearts of men, and          
Spirt-souls, and the dead. Thy soul dwelleth in Tetu, and the awe of        
thee is in Hensu. Thou settest the visible emblems of thyself in            
Anu, and the majesty of thy transformations in the holy place. I            
have come unto thee. Truth is in my heart, and in my breast there is        
neither craft nor guile. Grant thou that I may have my being among the      
living, and that I may sail up and down the river among those who           
are in thy following.                                                       
                                                                            
PRAISE_TO_HATHOR_LADY_OF_AMENTET                                            
  THE CHAPTER OF THE PRAISE OF HATHOR, LADY OF AMENTET                      
-                                                                           
  Hathor, Lady of Amentet, the Dweller in the Great Land, the Lady          
of Ta-Tchesert, the Eye of Ra, the Dweller in his breast, the               
Beautiful Face in the Boat of Millions of Years, the Seat of Peace          
of the doer of truth, Dweller in the Boat of the favoured ones.....         
                                                                            
APPENDIX                                                                    
  APPENDIX                                                                  
  THE CHAPTER OF THE FOUR TORCHES                                           
  (From the Papyrus of Nu, Sheets 26 and 27)                                
-                                                                           
  THE CHAPTER OF THE FOUR LIGHTED LAMPS WHICH ARE MADE FOR THE              
SPIRIT-SOUL. Behold, thou shalt make four rectangular troughs of            
clay wherein thou shalt scatter incense, and thou shalt fill them with      
the milk of a white cow, and by means of these thou shalt extinguish        
the lamps. The Osiris Nu, the steward of the overseer of the seal,          
whose word is truth, saith:- The fire cometh to thy KA, O Osiris            
Khenti-Amenti! The fire cometh to thy KA, O Osiris Nu, whose word is        
truth. The ordering of the night cometh after the day. [The fire            
cometh to thy KA, O Osiris, Governor of those who are in Amenti],           
and the two sisters of Ra come likewise. Behold it (the fire) riseth        
in Abtu, and it cometh; I cause it to come, the Eye of Horus. It is         
set in order upon thy brow, O Osiris Khenti-Amenti; it is set in thy        
shrine and riseth on thy brow; it is set on thy brow, O Osiris Nu,          
it is set on thy brow. The Eye of Horus protecteth thee, O Osiris           
Khenti-Amenti, and it keepeth thee in safety; it casteth down headlong      
all thine enemies for thee, and all thine enemies have fallen down          
headlong before thee. O Osiris Nu, the Eye of Horus protecteth thee,        
it keepeth thee in safety, and it casteth down headlong all thine           
enemies. Thine enemies have fallen down headlong before thy KA, O           
Osiris Khenti-Amenti. The Eye of Ra protecteth thee, it keepeth thee        
in safety, and it hath cast down headlong all thine enemies. Thine          
enemies have fallen down headlong before thy KA, O Osiris Nu, whose         
word is truth. The Eye of Horus protecteth thee, it keepeth thee in         
safety, it hath cast down headlong for thee all thine enemies, and          
thine enemies have fallen down headlong before thee. The Eye of             
Horus cometh. It is sound and well, it sendeth forth light even as          
doth Ra in the horizon. It covereth the powers of Suti with                 
darkness, it mastereth him, and it bringeth its flame against him by        
its own command. The Eye of Horus is sound and well, thou eatest the        
flesh thereof, thy body possesseth it. Thou acclaimest it. The Four         
Fires enter into thy KA, O Osiris Khenti-Amenti, the Four Fires             
enter into thy KA, O Osiris Nu, the steward of the overseer of the          
seal, whose word is truth.                                                  
  Hail, ye sons of Horus, Kesta, Hapi, Tuamutef, and Qebhsenuf, ye          
have given your protection to your divine Father Osiris Khenti-Amenti,      
give ye your protection to the Osiris Nu, whose word is truth. Now          
therefore, inasmuch as ye have destroyed the Opponent of Osiris             
Khenti-Amenti, who liveth with the gods, having smitten Suti with           
his right hand and arm when dawn came upon the earth, and Horus hath        
become master [of Suti], and hath avenged his divine Father himself;        
and inasmuch as your divine Father hath been made to flourish               
through the union of the KA of Osiris Khenti-Amenti, whch ye effected,      
and the Eye of Horus hath avenged him, and hath protected him, and          
hath cast down headlong for him all his enemies, and all his enemies        
have fallen down before him, even so do ye destroy the Opponent of the      
Osiris Nu, the steward of the overseer of the seal, whose word is           
truth. Let him live with the gods, let him smite his enemy, let him         
destroy him, when light dawneth on the earth. Let Horus be master           
and avenge the Osiris Nu, and let the Osiris Nu flourish through his        
union with his KA which ye have effected. O Osiris Nu, the Eye of           
Horus hath avenged thee. It hath cast down headlong all thine               
enemies for thee, and all thine enemies have been cast down headlong        
before thee.                                                                
  Hail, Osiris Khenti-Amenti, grant thou light and fire to the perfect      
Heart-soul which is in Hensu. And [O ye Sons of Horus], grant ye power      
unto the living heart-soul of the Osiris Nu by means of his fire.           
Let him not be repulsed, and let him not be driven back at the doors        
of Amentet! Let his offerings of bread and of linen garments be             
brought unto him among the lords of funeral oblations. O offer ye           
praises, as unto a god to the Osiris Nu, the destroyer of his Opponent      
in his form of Truth, and in his attributes of a god of truth.              
                                                     {APPENDIX ^paragraph 5}
-                                                                           
  RUBRIC: [This Chapter] shall be recited over four torches of atma         
cloth, which hath been anointed with the finest Thehennu unguent,           
and the torches shall be placed in the hands of four men who shall          
have the names of the pillars of Horus written upon their shoulders,        
and they shall burn the torches in the beautiful light of Ra, and this      
shall confer power and might upon the Spirit-soul of the deceased           
among the stars which never set. If this Chapter be recited for him he      
shall never, never perish, and he shall become a living soul for ever.      
These torches shall make the Spirit-soul to flourish like Osiris            
Khenti-Amenti, regularly and continually for ever. It is a struggle.        
Thou shalt not perform this ceremony before any human being except          
thine own self, or thy father, or thy son, because it is an                 
exceedingly great mystery of the Amentet, and it is a type of the           
hidden things of the Tuat. When this ceremony hath been performed           
for the deceased, the gods, and the Spirit-souls, and the dead shall        
see him in the form of Khenti-Amenti, and he shall have power and           
dominion like this god.                                                     
-                                                                           
  If thou shalt undertake to perform for the deceased that which is         
ordered in this "Chapter of the four blazing torches," each day,            
thou shalt cause the form of the deceased to come forth from every          
hall [in the Tuat], and from the Seven Halls of Osiris. And he shall        
live in the form of the God. He shall have power and dominion               
corresponding to those of the gods and the Spirit-souls for ever and        
ever. He shall enter in through the secret pylons and shall not be          
turned back in the presence of Osiris. And it shall come to pass,           
provided that the following things be done for him, that he shall           
enter in and come forth. He shall not be turned back. No boundary           
shall be set to his goings, and the sentence of the doom shall not          
be passed upon him on the Day of the Weighing of Words before               
Osiris- never, never.                                                       
  And thou shalt perform whatsoever [is written in] this book on            
behalf of the deceased, who shall thereby become perfect and pure. And      
thou shalt "open his mouth" with the instrument of iron. And thou           
shalt write down these things in accordance with the instructions           
which are found in the books of Prince Herutataf, who discovered            
them in a secret coffer (now they were in the handwriting of the god        
[Thoth] himself and had been deposited in the Temple of the goddess         
Unnut, the Lady of Unu) during a journey which he was making in             
order to inspect the temples, and the temple-estates, and the               
sanctuaries of the gods. And thou shalt perform these ceremonies            
secretly in the Tuat-chamber of the tomb, for they are mysteries of         
the Tuat, and they are symbolic of the things which are done in             
Khert-Neter.                                                                
                                                    {APPENDIX ^paragraph 10}
  And thou shalt say: I have come, I have advanced hastily. I cast          
light upon his (the deceased's) footsteps. I am hidden, but I cast          
light upon his hidden place. I stand up close to the Tet. I stand up        
close to the Tet of Ra, I turn back the slaughter. I am protecting          
thee, O Osiris.                                                             
-                                                                           
  RUBRIC: This Chapter shall be recited over a Tet of crystal, which        
shall be set upon a brick made of crude mud, whereupon this Chapter         
hath been inscribed. Thou shalt make a cavity in the west wall [of the      
tomb], and having turned the front of the Tet towards the east, thou        
shalt wall up the cavity with mud which hath been mixed with extract        
of cedar. This Tet shall drive away the enemies of Osiris who would         
set themselves at the east wall [of the tomb].                              
-                                                                           
  And thou shalt say: I have driven back thy foes. I keep watch over        
thee. He that is upon his mountain (Anpu) keepeth watch over thee           
ready for the moment when thy foes shall attack thee, and he shall          
repulse them for thee. I will drive back the Crocodile at the moment        
when it attacketh thee, and I will protect thee, O Osiris Nu.               
                                                    {APPENDIX ^paragraph 15}
-                                                                           
  RUBRIC: This Chapter shall be recited over a figure of Anpu made          
of crude mud mixed with incense. And the figure shall be set upon a         
brick made of crude mud, whereupon this Chapter hath been inscribed.        
Thou shalt make a cavity in the east wall, and having turned the            
face of the figure of Anpu towards the west wall [therein] thou             
shalt wall up the cavity. This figure shall repulse the enemies of          
Osiris, who would set themselves at the south wall.                         
-                                                                           
  And thou shalt say; I am the belt of sand round about the hidden          
coffer. I turn back the force of the blazing fire of the funerary           
mountain. I traverse the roads, and I protect the Osiris Nu, the            
steward of the overseer of the seal, whose word is truth.                   
-                                                                           
                                                    {APPENDIX ^paragraph 20}
  RUBRIC: This Chapter shall be recited over a brick made of crude mud      
whereon a copy of this Chapter hath been inscribed. And thou shalt          
place a reed in the middle thereof, and thou shalt smear it with            
pitch, and set light thereto. Then thou shalt make a cavity in the          
south wall, and, having turned the front of the brick towards the           
north, thou shalt wall the brick up inside it. [It shall repulse the        
enemies of the Osiris Nu] who would assemble at the north wall.             
-                                                                           
  And thou shalt say: O thou who comest to set fire [to the tomb or         
mummy], I will not let thee do it. O thou who comest to cast fire           
[herein], I will not let thee do it. I will burn thee, and I will cast      
fire upon thee. I protect the Osiris Nu, the steward of the overseer        
of the seal, whose word is truth.                                           
-                                                                           
  RUBRIC: This Chapter shall be recited over a brick of crude mud,          
whereon a copy of this Chapter hath been inscribed. [And thou shalt         
set upon it] a figure of the deceased made of palm wood, seven fingers      
in height. And thou shalt perform on it the ceremony of "Opening the        
Mouth." Then thou shalt make a cavity in the north wall, and having         
[placed the brick and the figure inside it], and turned the face of         
the figure towards the south, thou shalt wall up the cavity. [It shall      
repulse the enemies of the Osiris Nu], who would assemble at the south      
wall.                                                                       
                                                    {APPENDIX ^paragraph 25}
-                                                                           
  And behold, these things shall be done by a man who is washed clean,      
and is ceremonially pure, and who hath eaten neither meat nor fish,         
and who hath not [recently] had intercourse with women. And behold,         
thou shalt make offerings of cakes and ale to these gods, and shalt         
burn incense on their fires. Every Spirit-soul for whom these things        
shall be done shall become like a holy god in Khert-Neter, and he           
shall not be turned back at any gate in Amentet, and he shall be in         
the following of Osiris, whithersoever he goeth, regularly and              
continually.                                                                

[[category:Legendary]]